Questions tagged [mutations]

Nucleotide base changes in the genome from its parental copy which for eukaryotes or bacteria is DNA

Filter by
Sorted by
Tagged with
0 votes
1 answer
13 views

VCF or BAM file for raw data of gene test?

My friend has a VUS (Polymicrogyria with or without VEDS) mutation that was found in her whole-exome sequencing with respect to the phenotype given that time. At present, her doctors have more ...
user avatar
-2 votes
2 answers
65 views

Error in running Mutect2

I am trying to run Mutect2 on a .bam file but I get an error by Googling can not be tackled Have you seen this error? ...
user avatar
  • 1,513
1 vote
0 answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
user avatar
  • 143
2 votes
1 answer
32 views

Counting the co-occurrence of variants A and B in an aligned sequencing read

I need some help getting started on this project. To simplify we want to be able to quantify the occurrence of 3 variants on each sequencing read in an alignment file as a proxy measurement for ...
user avatar
  • 21
1 vote
1 answer
23 views

A unified database for CNV, SNP, Indel and MSI

I am looking for a database or different databases where I can find information on different gene variants for a gene. As an example if I enter PPARG, I could be able to see SNPs, CNV, InDels and MSI. ...
user avatar
  • 165
0 votes
0 answers
33 views

Detection of biallelic mutation (inactivation)

By biallelic mutation (inactivation), I mean several cases: The first mutation is inherited (germline) mutation and the second mutation occurs as somatic at other loci, but within the same gene. Each ...
user avatar
  • 191
1 vote
1 answer
166 views

How do I create a VCF file of all known pathogenic mutations in a gene of interest?

I would like to create a list (probably .vcf format would be good) of all known pathogenic missense mutations in a human gene of interest and then add other variants that could lead to the same ...
user avatar
  • 11
1 vote
1 answer
50 views

How to calculate various properties of a protein structure per atom using PDB2PQR and Rosetta tools (or any other tools)?

Currently, I am implementing a descriptor of protein structure and would like to calculate properties per atoms like charges, hydrophobicity, hydrogen bond donors / acceptors, hydrophobicity, ...
user avatar
1 vote
1 answer
77 views

>My counter is counting genotypic combination occurences more than once, how do I ensure it counts one combination and doesnt count it again?

...
user avatar
0 votes
0 answers
42 views

Somatic mutations for normal WES samples

I am trying to identify somatic mutations on healthy subjects (specifically in WES samples). As of now, I have found a couple of papers who have done similar studies such as this paper where somatic ...
user avatar
1 vote
0 answers
13 views

How do I include repeat purity, default slippage, default stutter, and minimum flanking (left and right) in Tandem Repeat Finder's output?

I am attempting to create a markerInfoFile for use in a program called popSTR (GitHub Documentation: https://github.com/DecodeGenetics/popSTR). The marker info file should contain information about ...
user avatar
0 votes
1 answer
52 views

Is there a way to customize what observations are plotted in ComplexHeatmap?

So right now my observations in the dataset I've processed is stored as sample identifier columns and gene rows: an example of this would be for sample 1 and gene TRIM21 the observation is Missense ...
user avatar
1 vote
0 answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
user avatar
0 votes
1 answer
167 views

How to calculate mutation rate and mutation sites in a genome using FASTA file?

I have 6 viral genome sequences of the same virus and 1 reference sequence in FASTA format. How I can identify mutations and mutation sites in those genomes using FASTA sequences but how I can do ...
user avatar
  • 59
1 vote
1 answer
55 views

Model the effect of treatment on mutation burden

I am struggling a bit to model the following problem. Basically, I would like to model tumor mutation burden (mutations per megabase, a continuous) as a function of treatment (categorical). The ...
user avatar
  • 21
1 vote
2 answers
78 views

Is there a tool for synonymous recoding of DNA sequences?

I've got a DNA sequence that I'd like to make synonymous mutations throughout, thereby preserving the amino acid sequence. Does anyone know of a tool to achieve this
user avatar
  • 113
0 votes
1 answer
39 views

Is there a aminoacid mutation that forms similar protein? [closed]

Is there an amino-acid shift that will 99% of the time end up resulting the same biochemical function/structure and implications? Like Alanine replaced by Leucine will code in 99% of the cases(at any ...
user avatar
0 votes
1 answer
61 views

Finding difference between groups

I have mutational catalogues of 4 samples like below ...
user avatar
  • 1,513
1 vote
1 answer
23 views

Scooping and GeneMatcher

A colleague has uploaded about a dozen candidate disease genes to GeneMatcher, described here and here and located here, with excellent success. However last year and again recently he has ...
user avatar
  • 3,434
1 vote
1 answer
66 views

Are there databases to annotate non-coding mutations?

I would like to ask if there are some known databases that allows to annotate non-coding mutations in a given region for the human genome? Preferably, if the database is downloadable so I am able to ...
user avatar
1 vote
0 answers
27 views

Need help in identifying origin of variants in CIVIC

We usually denote the origin of a mutation as either somatic or germline. This information is usually available in certain databases such as CIVIC, ClinVar, COSMIC etc. But when we come to variants ...
user avatar
0 votes
1 answer
210 views

Plot a circos plot to show the consistency between 2 samples

I have called SNP and INDEL in two matched samples by strelka and extract this information from .vcf file and I have these ...
user avatar
  • 1,513
0 votes
0 answers
164 views

maf file format: Variant_Classification value for non frameshift substitution

I have a vcf containing SNV and MNV (short indells or substitutions), I annotate that file whit annovar and in the resulting txt file I have this row ...
user avatar
  • 255
3 votes
3 answers
102 views

Which gene I should select from this qqplot [closed]

I have a qqplot of my whole genome sequencing data; A plot is for showing possibly significant driver genes. I tried to read about qqplot though but people only say about the skewedness while I want ...
user avatar
  • 1,513
1 vote
0 answers
44 views

How to select point mutations from MAF file

I am using a mutation MAF file from GDC. I want to select for point mutations, therefore I selected Variant_Classification equal to ...
user avatar
  • 1,713
2 votes
0 answers
146 views

Meaning of category in MutSigCV

I am trying to understand the working of MutSigCV. But I am not sure about some terms used in MAF file format which is category. According to MutSigCV, every mutation can be divided into the following ...
user avatar
3 votes
1 answer
49 views

How can I get a list of papers where a particular mutation has been mentioned?

I have recently tried a few tools (MutationFinder, tmVar, PubTator etc.) that extract mutations from a given text. However, for my work I need something that will take a list of mutations as an input ...
user avatar
2 votes
1 answer
70 views

how to do analysis of a table content SNP?

I have a table with information about SNPs, the table has a total of 55127 rows. How can I know the number of gene mutations in the table and if a gene is present? The table is in xls format.
user avatar
  • 341
2 votes
1 answer
202 views

How to get unique somatic mutations for each individual patients

I have exome data 32 patients. My aim is to identify unique somatic mutations in each patients. For this I have completed my pipeline for Whole Exome Data analysis using various tools like BWA mem, ...
user avatar
0 votes
1 answer
104 views

Information about control data

I am putting this question because I did not find any useful information from internet because of limited access. My question is related to control (or normal) data that we use for somatic mutation ...
user avatar
1 vote
1 answer
499 views

Comparing two multi-fasta files of the same set of proteins with parser - to find and count mutations after treatment

My task is to count the mutations occurred in several proteins after a treatment. The sequences are all present in the two files in the same order. I opened both files with the FASTA parser (...
user avatar
5 votes
3 answers
199 views

Show presence of known mutation in RNA-seq data

We have RNA-seq fastq data from control (WT) patients and a patient with a point mutation at a known location in one gene. I'd like to retrieve the reads aligning to that gene and show the presence of ...
user avatar
  • 2,554
1 vote
1 answer
58 views

Which tools are available to call somatic mutations on non-coding regions from whole genome sequencing data?

I have a set of whole genome sequencing samples, some of which have matched normal while some not. I want to call somatic mutations on non-coding regions. I was looking for GATK best practices (like ...
user avatar
  • 1,713
11 votes
1 answer
362 views

State of the art mutation simulation software

There are many features affecting mutation probabilities, e.g. CpG mutations are 10-fold more likely than other types of mutations. Is there a model (preferably with software) which can take two ...
user avatar