Questions tagged [mutations]

Nucleotide base changes in the genome from its parental copy which for eukaryotes or bacteria is DNA

Filter by
Sorted by
Tagged with
1
vote
1answer
110 views

How do I create a VCF file of all known pathogenic mutations in a gene of interest?

I would like to create a list (probably .vcf format would be good) of all known pathogenic missense mutations in a human gene of interest and then add other variants that could lead to the same ...
1
vote
1answer
47 views

Model the effect of treatment on mutation burden

I am struggling a bit to model the following problem. Basically, I would like to model tumor mutation burden (mutations per megabase, a continuous) as a function of treatment (categorical). The ...
1
vote
0answers
25 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
2
votes
1answer
29 views

Counting the co-occurrence of variants A and B in an aligned sequencing read

I need some help getting started on this project. To simplify we want to be able to quantify the occurrence of 3 variants on each sequencing read in an alignment file as a proxy measurement for ...
0
votes
1answer
58 views

Finding difference between groups

I have mutational catalogues of 4 samples like below ...
1
vote
1answer
22 views

A unified database for CNV, SNP, Indel and MSI

I am looking for a database or different databases where I can find information on different gene variants for a gene. As an example if I enter PPARG, I could be able to see SNPs, CNV, InDels and MSI. ...
0
votes
0answers
25 views

Detection of biallelic mutation (inactivation)

By biallelic mutation (inactivation), I mean several cases: The first mutation is inherited (germline) mutation and the second mutation occurs as somatic at other loci, but within the same gene. Each ...
2
votes
1answer
26 views

Python package or CLI tool outputting mutations of sequence with respect to reference

I'm new to bioinformatics, and I'm looking for a tool that takes two FASTA files, one containing a reference, let's call it A.fasta, the other another sequence, let'...
1
vote
1answer
37 views

How to calculate various properties of a protein structure per atom using PDB2PQR and Rosetta tools (or any other tools)?

Currently, I am implementing a descriptor of protein structure and would like to calculate properties per atoms like charges, hydrophobicity, hydrogen bond donors / acceptors, hydrophobicity, ...
0
votes
1answer
137 views

How to calculate mutation rate and mutation sites in a genome using FASTA file?

I have 6 viral genome sequences of the same virus and 1 reference sequence in FASTA format. How I can identify mutations and mutation sites in those genomes using FASTA sequences but how I can do ...
1
vote
2answers
72 views

Is there a tool for synonymous recoding of DNA sequences?

I've got a DNA sequence that I'd like to make synonymous mutations throughout, thereby preserving the amino acid sequence. Does anyone know of a tool to achieve this
1
vote
1answer
21 views

Scooping and GeneMatcher

A colleague has uploaded about a dozen candidate disease genes to GeneMatcher, described here and here and located here, with excellent success. However last year and again recently he has ...
0
votes
0answers
41 views

Somatic mutations for normal WES samples

I am trying to identify somatic mutations on healthy subjects (specifically in WES samples). As of now, I have found a couple of papers who have done similar studies such as this paper where somatic ...
1
vote
0answers
11 views

How do I include repeat purity, default slippage, default stutter, and minimum flanking (left and right) in Tandem Repeat Finder's output?

I am attempting to create a markerInfoFile for use in a program called popSTR (GitHub Documentation: https://github.com/DecodeGenetics/popSTR). The marker info file should contain information about ...
0
votes
0answers
152 views

maf file format: Variant_Classification value for non frameshift substitution

I have a vcf containing SNV and MNV (short indells or substitutions), I annotate that file whit annovar and in the resulting txt file I have this row ...
0
votes
1answer
38 views

Is there a way to customize what observations are plotted in ComplexHeatmap?

So right now my observations in the dataset I've processed is stored as sample identifier columns and gene rows: an example of this would be for sample 1 and gene TRIM21 the observation is Missense ...
1
vote
0answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
11
votes
1answer
358 views

State of the art mutation simulation software

There are many features affecting mutation probabilities, e.g. CpG mutations are 10-fold more likely than other types of mutations. Is there a model (preferably with software) which can take two ...
0
votes
1answer
37 views

Is there a aminoacid mutation that forms similar protein? [closed]

Is there an amino-acid shift that will 99% of the time end up resulting the same biochemical function/structure and implications? Like Alanine replaced by Leucine will code in 99% of the cases(at any ...
5
votes
3answers
195 views

Show presence of known mutation in RNA-seq data

We have RNA-seq fastq data from control (WT) patients and a patient with a point mutation at a known location in one gene. I'd like to retrieve the reads aligning to that gene and show the presence of ...
1
vote
1answer
61 views

Are there databases to annotate non-coding mutations?

I would like to ask if there are some known databases that allows to annotate non-coding mutations in a given region for the human genome? Preferably, if the database is downloadable so I am able to ...
1
vote
0answers
27 views

Need help in identifying origin of variants in CIVIC

We usually denote the origin of a mutation as either somatic or germline. This information is usually available in certain databases such as CIVIC, ClinVar, COSMIC etc. But when we come to variants ...
0
votes
1answer
193 views

Plot a circos plot to show the consistency between 2 samples

I have called SNP and INDEL in two matched samples by strelka and extract this information from .vcf file and I have these ...
3
votes
3answers
96 views

Which gene I should select from this qqplot [closed]

I have a qqplot of my whole genome sequencing data; A plot is for showing possibly significant driver genes. I tried to read about qqplot though but people only say about the skewedness while I want ...
2
votes
1answer
194 views

How to get unique somatic mutations for each individual patients

I have exome data 32 patients. My aim is to identify unique somatic mutations in each patients. For this I have completed my pipeline for Whole Exome Data analysis using various tools like BWA mem, ...
0
votes
1answer
104 views

Information about control data

I am putting this question because I did not find any useful information from internet because of limited access. My question is related to control (or normal) data that we use for somatic mutation ...
1
vote
0answers
41 views

How to select point mutations from MAF file

I am using a mutation MAF file from GDC. I want to select for point mutations, therefore I selected Variant_Classification equal to ...
1
vote
0answers
142 views

Meaning of category in MutSigCV

I am trying to understand the working of MutSigCV. But I am not sure about some terms used in MAF file format which is category. According to MutSigCV, every mutation can be divided into the following ...
3
votes
1answer
48 views

How can I get a list of papers where a particular mutation has been mentioned?

I have recently tried a few tools (MutationFinder, tmVar, PubTator etc.) that extract mutations from a given text. However, for my work I need something that will take a list of mutations as an input ...
2
votes
1answer
66 views

how to do analysis of a table content SNP?

I have a table with information about SNPs, the table has a total of 55127 rows. How can I know the number of gene mutations in the table and if a gene is present? The table is in xls format.
1
vote
1answer
450 views

Comparing two multi-fasta files of the same set of proteins with parser - to find and count mutations after treatment

My task is to count the mutations occurred in several proteins after a treatment. The sequences are all present in the two files in the same order. I opened both files with the FASTA parser (...
1
vote
1answer
57 views

Which tools are available to call somatic mutations on non-coding regions from whole genome sequencing data?

I have a set of whole genome sequencing samples, some of which have matched normal while some not. I want to call somatic mutations on non-coding regions. I was looking for GATK best practices (like ...