Questions tagged [mutations]

Nucleotide base changes in the genome from its parental copy which for eukaryotes or bacteria is DNA

13 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
1
vote
0answers
14 views

What is meant by "mean ratio" with regards to a gene deletion in the DECIPHER genomics database?

I am looking at patients who have deletion of the CNTN4 gene in the DECIPHER genomics database. In the entry for the patient, underneath the type of mutation (Deletion) is the following term: "...
1
vote
0answers
25 views

Visualization of mutations in (part of) viral genome - existing tools?

I'm trying to visualize mutations in SARS-CoV-2 sequences, somewhat like it's done on outbreak.info: but for individual sequences, probably on the base of the vcf files generated by the ARTIC ...
1
vote
0answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
1
vote
0answers
12 views

How do I include repeat purity, default slippage, default stutter, and minimum flanking (left and right) in Tandem Repeat Finder's output?

I am attempting to create a markerInfoFile for use in a program called popSTR (GitHub Documentation: https://github.com/DecodeGenetics/popSTR). The marker info file should contain information about ...
1
vote
0answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
1
vote
1answer
51 views

Model the effect of treatment on mutation burden

I am struggling a bit to model the following problem. Basically, I would like to model tumor mutation burden (mutations per megabase, a continuous) as a function of treatment (categorical). The ...
1
vote
0answers
27 views

Need help in identifying origin of variants in CIVIC

We usually denote the origin of a mutation as either somatic or germline. This information is usually available in certain databases such as CIVIC, ClinVar, COSMIC etc. But when we come to variants ...
1
vote
0answers
41 views

How to select point mutations from MAF file

I am using a mutation MAF file from GDC. I want to select for point mutations, therefore I selected Variant_Classification equal to ...
1
vote
0answers
142 views

Meaning of category in MutSigCV

I am trying to understand the working of MutSigCV. But I am not sure about some terms used in MAF file format which is category. According to MutSigCV, every mutation can be divided into the following ...
0
votes
0answers
25 views

Detection of biallelic mutation (inactivation)

By biallelic mutation (inactivation), I mean several cases: The first mutation is inherited (germline) mutation and the second mutation occurs as somatic at other loci, but within the same gene. Each ...
0
votes
0answers
42 views

Somatic mutations for normal WES samples

I am trying to identify somatic mutations on healthy subjects (specifically in WES samples). As of now, I have found a couple of papers who have done similar studies such as this paper where somatic ...
0
votes
1answer
60 views

Finding difference between groups

I have mutational catalogues of 4 samples like below ...
0
votes
0answers
156 views

maf file format: Variant_Classification value for non frameshift substitution

I have a vcf containing SNV and MNV (short indells or substitutions), I annotate that file whit annovar and in the resulting txt file I have this row ...