Stack Exchange Network

Stack Exchange network consists of 174 Q&A communities including Stack Overflow, the largest, most trusted online community for developers to learn, share their knowledge, and build their careers.

Visit Stack Exchange

Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of dna/protein sequences alignment i.e arranging sequences in order to find similarity between sequences.

0
votes
1answer
31 views

How BLOSUM Matrix is constructed and calculated

I would like to ask how BLOSUM matrix is constructed and calculated ? I read the wikipedia and I still do not understand it. I do not understand the mathematical calculations as I have low knowledge ...
4
votes
1answer
63 views

Understanding the initialization of the Needleman-Wunsch algorithm

I would like to ask why when we initialize 0 as the starting point, there are 3 gray boxes that are not used as shown (highlighted in the red box) in the pic? Are these boxes to show that they are ...
4
votes
1answer
57 views

How to output all sequences with bwa mem, not `*`?

I've been running bwa mem -a for alignment, using the -a flag---this will output all alignments for SE or unpaired PE I've ...
5
votes
4answers
581 views

What is a simple command line tool for doing Needleman-Wunsch pair-wise alignment on the command line

I have two DNA strings: GGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGC and AGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGG I want a tool that allows me to do something like this on the ...
2
votes
2answers
69 views

Fast and reliable alternatives to blast

After some unexpected results (and previously reported) I heard that there are other tools for finding similar sequences besides blast that are faster and more accurate. I only found hmmer, but I don'...
4
votes
1answer
30 views

Does the “.full.aln” file produced by snippy-core contain all bases of my input sequences aligned to the reference genome?

I have a number of sequences and a reference genome. I used snippy to align each individual sequence with the reference genome. I then used ...
4
votes
2answers
96 views

full visualisation of draft genomes alignment

I have two draft genomes (aprox. 500Mb each), one with ~10'000 scaffolds (genome1.fasta) and one with ~1'000 contigs (...
0
votes
1answer
29 views

Exporting nt's differences from MEGA alignment

I have an alignment of some full genome sequences of DENV1 that we have recently sequenced from the serum of patients. I have already cleaned the sequences, built the alignments and done the SNPs ...
0
votes
0answers
35 views

scoring matrices computation from transition probability matrix

The transition probability matrix over time t is computed as P(t) = e ^Qt. In order to calculate a general set of transition probability matrices what type of t values can be used ( t = expected ...
3
votes
0answers
70 views

Sequence alignment using BWT

My Problem: Skipping some specific background, what I want to do is judging whether some soft-clipping sequences are the same, which may result by the same SV event. Colored bases in Fig.1 is an ...
0
votes
0answers
31 views

How to create a dendrogram of clusters and reconstruct phylogenetic relationship

I'm working with a Daphnia data set looking at the 16s gene pulled from the BOLD database. So far I did a multiple sequence alignment and attempted to cluster and plot a dendrogram: ...
1
vote
1answer
34 views

What are “split reads” and “intron clusters?”

I'm working through the example data set for LeafCutter and the documentation mentions "split reads": This will cluster together the introns fond [sic] in the junc files listed in test_juncfiles....
2
votes
0answers
35 views

How to assign the best gap penalty and gap extension penalty using BLOSUM65

For an assignment I must do a pairwise optimal local alignment using BLOSUM65 and five protein sequences. The algorithm I want to use is the Smith-Waterman. Context protein sequencing using Blastp: ...
1
vote
1answer
72 views

Aligning sequence and comparing it against primer

I am looking to show how a primer is consistent among some genomic data. I have a primer of about 23bp and looking to compare it to about 5000 genomic sequences of 10kb. I am unsure how to format it ...
0
votes
1answer
64 views

Find a map/correspondence between two versions of a genome

I am working with two versions of the C. elegans genome. I am finding interesting regions (specifically, tRNA genes) in version 1 and then I would like to know if version 2 also has a tRNA gene in ...
1
vote
0answers
58 views

How to make year scale bar unit in figtree software?

I have generated phylogenetic trees for virus sequences by using beast software. I observed in various research articles that the phylogentic trees also have a scale-bar (which mostly represents ...
1
vote
0answers
22 views

Alignment using secondary and tertiary features of DNA

I m trying to align different sequences of length not greater than 50. Is there any way to incorporate other information such as stacking energy, entropy, bonds etc. If there any way to align ...
3
votes
0answers
69 views

Merging ssu-align alignments

ssu-align is an HMM-based MSA tool for ribosome's small subunit (SSU) sequences. It's bundled with three SSU models: archaeal, bacterial and eukaryotic. Given a set of archaeal and bacterial sequences ...
5
votes
1answer
154 views

Better aligner than bowtie2?

Bowtie2 is probably the most widely used aligner because of it's speed. Burrow-wheeler (BW) algorithms (including bwa) tend to ...
0
votes
0answers
40 views

Interpreting bayesian phylogenetic model using Tracer?

I am doing phylodynamic analysis of virus sequences using bayesian method using BEAUti and BEAST. As a part of my analysis I am using Tracer to check how my model is working. I can interpret some of ...
5
votes
1answer
56 views

Why aren't clustal alignments stable under deletion of some of the sequences?

I'm new to pairwise and multiple sequence alignment in general, but I thought I understood how clustal works -- k-tuple distance is a cheap metric that's 'probably approximately' monotonic in the real ...
8
votes
2answers
124 views

Is there a standard definition for “assembly polishing”?

Is there a standard definition for "assembly polishing" in the field? Is there a standard definition for what polishing algorithms do? My understanding of "polishing" is strongly influenced by ...
4
votes
1answer
136 views

BLAST(n): No hits found

I am currently exploring the BLAST program, just for testing purpose i generated two FASTA files, containing two genes A and B, such that B is just a motif of repeated 'G's that occurs in A. file A....
0
votes
0answers
38 views

Mugsy error: Can't find species II dna at output/software/mugsy_x86-64-v1r2.3/mugsy line 501

I have installed mugsy in order to create a multiple genome alignment and a phylogenetic tree of several species of nematodes. The following command successfully pulls out the help: ...
4
votes
1answer
75 views

Are there certain alignment methods/tools which perform better with a high density of indels?

I have a set of experiments which should result in WGS reads with a high density of indels. Question: Are there certain alignment tools/methods which perform respectively "better" with these reads? ...
1
vote
0answers
59 views

igv_plotter error: Xvfb did not start

I am trying to get screenshots from alignments of reads to a genome in IGV (Integrated Genome Viewer) using igv_plotter. ...
-2
votes
1answer
81 views

Command not found error on HISAT2

I have been attempting to map reads to a reference genome using HISAT2 using the Pertea, et al 2016 Nature Protocols paper. I am able to successfully generate an index (using the hisat2-build command),...
5
votes
1answer
94 views

Evaluate clusters of individuals by using their sequence data

For a dataset of several hundred individuals, I applied a hierarchical clustering to generate clusters based on a functional trait that sets them apart. My task is now to evaluate if these clusters ...
0
votes
1answer
64 views

Creating frequency plot from weblogo with frequency unit on the Y axis

Hello I am trying to create frequency plot for a motif with frequency unit on the Y axis from 0 -100 nt as the unit as represented in this paper.(Seiler et al., 2018)
6
votes
1answer
71 views

Does the DNA or RNA of some ethnic groups map better than others' to the human reference genome sequence?

I believe that the human genome reference took DNA samples from different people and that some natural variation is included in extra contigs. However, the human reference genome comes from a ...
5
votes
3answers
176 views

Generating the reconstructed alignment from BAM

I have a (small) BAM file with CIGAR and MD fields. Question 1: What tools exists in Python and/or R to reconstruct the alignment between the reference and the read in a BAM? Given that this is a ...
2
votes
1answer
90 views

Can I export the SNPs between whole genome alignments using the command line?

I am using Mauve to align two whole genomes. I use the following command to get the alignment in xmfa format: ...
0
votes
1answer
58 views
3
votes
1answer
421 views

Can I index a compressed FASTA file using STAR?

I am using STAR to align RNA-seq reads to a reference genome. Before the alignment, I need to generate an index of the reference genome. I use the following code to generate the index successfully: <...
2
votes
2answers
108 views

How to read .bwt file .sa file?

In BWA project in bwt.c file I found bwt_dump_bwt method and bwt_dump_sa method. I want to use them to read .bwt file and .sa file. I wrote the following program: ...
0
votes
2answers
138 views

How BWA generate index files?

I need to know how BWA generate bw and sa in less memory usage ? Do they save all rotations temporary ? I need to know do BWA stores all rotations so that it can sort the rotations alphabetically ? ...
2
votes
1answer
95 views

Generating burrows-wheeler-transform and a suffix array of a DNA sequence with less memory

Also posted on biostars After indexing bwa index -a bwtsw reference.fa I got files. like .bwt file and .sa file. The naive way of generating these file is:   ...
4
votes
2answers
57 views

How does Li and Durbin's BWA paper compare alignment programs on real data?

Li and Durbin's "Fast and accurate short read alignment with burrows-whleeler transform" found here, says: We evaluate the performance of BWA on ... real paired-end data by checking the fraction ...
1
vote
1answer
20 views

Why does RATT create a directory with chromosome sequences and how can I stop it?

I have run RATT to transfer the annotation from a reference strain to another strain. For this, I have run: ...
2
votes
1answer
72 views

How to generate a weblogo image that takes into account sequence frequencies?

I have a large aligned amino acid sequences file (fasta file) from next generation sequencing data. The unique sequences have been aligned but these all have certain read counts (frequencies ...
1
vote
2answers
38 views

Mapping bisulfite reads to a reduced size genome

Is it worth mapping bisulfite reads (WGBS) to a reduced size genome? I'm interested only in modifications in CpG context, thus instead of mapping to a whole genome (human genome) I would: Extract ...
3
votes
2answers
57 views

Is there a tool that can take a protein's amino acid sequence and would display it's locus on the genome?

I have the UNIPROT IDs, PDB IDs and FASTA files of several known proteins. I am looking for a tool that can take as input the protein's amino acid sequence and display the coding nucleotides of those ...
1
vote
0answers
44 views

Can Mauve export indels or is there an whole-genome aligner that can export indels?

I have aligned two whole genomes of the same species in Mauve using progressiveMauve. One of the genomes is 2 megabases longer than the other so I know it must contain some insertions. Looking at the ...
3
votes
2answers
99 views

What software/tool can I use to visualise a multiple sequence alignment in the xmfa format as produced by command-line tool Mauve?

What software/tool can I use to visualise a multiple sequence alignment in the xmfa format as produced by command-line tool Mauve? I am particularly interested in seeing the single nucleotide ...
-1
votes
1answer
61 views

Coordinates to Genome R Studio Script?

I have a very, very long list of genome coordinates of areas. I need to gather a sequence in order to compare it to another database of sequences that I have. How do I produce the genome sequences ...
4
votes
2answers
347 views

How to align genomic sequence with corresponding amino acid sequence

Does anyone know of a program that can align a genomic sequence with introns with the corresponding amino acid sequence? I have both the genomic sequence and the correct amino acid sequence but no ...
9
votes
1answer
437 views

Why does a very strong BLAST hit get lost when I change num_alignments, num_descriptions or max_target_seqs parameter?

Disclaimer: This is a self answered question for documentation purpose and I adapted this from the following github gist. Especially from users terrycojones and peterjc as well as sujaikumar who ...
5
votes
1answer
203 views

What is local realignment and what is the problem it solves?

I am trying to understand local realignment but I could not get a clear idea of what is the problem solved by it. For example, reading Homer and Nelson (2010): Because alignment algorithms map ...
1
vote
1answer
191 views

Filtering out all seqs with mutations of list2 from list1

I have 2 lists, list1 and list2, of protein sequences of the same given gene in different strains. In ...
0
votes
2answers
207 views

Mutations in sequences relative to reference (histogram)

I have a reference sequence of amino acids that I compare other sequences to using Bio.pairwise2.align.globalmx of Biopython package (one to many compare - one by ...