Stack Exchange Network

Stack Exchange network consists of 175 Q&A communities including Stack Overflow, the largest, most trusted online community for developers to learn, share their knowledge, and build their careers.

Visit Stack Exchange

Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

2
votes
2answers
29 views

Alignment with arbitrary number of mismatches or gaps

I have 23bp long reads and want to find all possible alignments of them to the human genome (hg19, hg38) for an arbitrary number of mismatches (<7), possibly also small indels. I've read in ...
2
votes
1answer
50 views

How to get fasta alignment file from SAM/BAM file?

I am not talking about consensus sequence, I know how to get consensus sequence using mpileup in samtools/bcftools. As I understand , SAM/BAM files are basically sequence alignment format so it's ...
4
votes
1answer
152 views

Why do I get so many insertions from Minimap2 on my Nanopore WGS?

I'm a starting my analysis on nanopore whole genome sequencing. I start my analysis from this popular Github. The sample I downloaded was WGS for NA12878, so I would assume it's alignment to GRCh38 ...
1
vote
2answers
64 views

Hardware Requirements (specs) for Bioinformatics-dedicated desktop [closed]

I know this is a somewhat general or vague question, but I’m interested in your opinions. I must build a desktop for general bioinformatics activities with human genomes. I will work with Python and R ...
3
votes
1answer
14 views

Seeking explanation of the hg38 files downloaded from bowtie 2 website

I downloaded the H. sapiens, NCBI GRCh38 files from Bowtie's website. After unzipping, there are 6 files, 4 that end in set 1.ebwt, set2.ebwt, set3.ebwt, and set4.ebwt and two that end in set.rev.1....
3
votes
1answer
21 views

Restricting match output for multiple sequence alignment using mafft?

So I aligned roughly 5k sequences and I got my output using mafft. However, I want to restrict the output to only present conserved segments of a specific length (let's say 25bp). Does mafft have ...
4
votes
1answer
126 views

Can blat use more than one core/CPU to speed up the alignment?

I am using BLAT to align two versions of the genome of C. elegans. I can see in the Activity Monitor of my Mac Book Pro High Sierra that blat is using 100% of a CPU....
5
votes
0answers
30 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
5
votes
5answers
97 views

Identifying Indels from Chromatograms

I have around 100 chromatograms (.ab1 files) from Sanger sequencing a genome at loci believed to have an indel. I'm new to interpreting this kind of data in ...
2
votes
3answers
94 views

How BLOSUM Matrix is constructed and calculated

I would like to ask how BLOSUM matrix is constructed and calculated ? I read the wikipedia and I still do not understand it. I do not understand the mathematical calculations as I have low knowledge ...
5
votes
1answer
81 views

Understanding the initialization of the Needleman-Wunsch algorithm

I would like to ask why when we initialize 0 as the starting point, there are 3 gray boxes that are not used as shown (highlighted in the red box) in the pic? Are these boxes to show that they are ...
5
votes
1answer
69 views

How to output all sequences with bwa mem, not `*`?

I've been running bwa mem -a for alignment, using the -a flag---this will output all alignments for SE or unpaired PE I've ...
6
votes
4answers
627 views

What is a simple command line tool for doing Needleman-Wunsch pair-wise alignment on the command line

I have two DNA strings: GGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGC and AGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGG I want a tool that allows me to do something like this on the ...
3
votes
3answers
101 views

Fast and reliable alternatives to blast

After some unexpected results (and previously reported) I heard that there are other tools for finding similar sequences besides blast that are faster and more accurate. I only found hmmer, but I don'...
5
votes
1answer
45 views

Does the “.full.aln” file produced by snippy-core contain all bases of my input sequences aligned to the reference genome?

I have a number of sequences and a reference genome. I used snippy to align each individual sequence with the reference genome. I then used ...
4
votes
1answer
122 views

full visualisation of draft genomes alignment

I have two draft genomes (aprox. 500Mb each), one with ~10'000 scaffolds (genome1.fasta) and one with ~1'000 contigs (...
0
votes
1answer
30 views

Exporting nt's differences from MEGA alignment

I have an alignment of some full genome sequences of DENV1 that we have recently sequenced from the serum of patients. I have already cleaned the sequences, built the alignments and done the SNPs ...
0
votes
0answers
37 views

scoring matrices computation from transition probability matrix

The transition probability matrix over time t is computed as P(t) = e ^Qt. In order to calculate a general set of transition probability matrices what type of t values can be used ( t = expected ...
3
votes
0answers
78 views

Sequence alignment using BWT

My Problem: Skipping some specific background, what I want to do is judging whether some soft-clipping sequences are the same, which may result by the same SV event. Colored bases in Fig.1 is an ...
1
vote
0answers
42 views

How to create a dendrogram of clusters and reconstruct phylogenetic relationship

I'm working with a Daphnia data set looking at the 16s gene pulled from the BOLD database. So far I did a multiple sequence alignment and attempted to cluster and plot a dendrogram: ...
3
votes
1answer
76 views

What are “split reads” and “intron clusters?”

I'm working through the example data set for LeafCutter and the documentation mentions "split reads": This will cluster together the introns fond [sic] in the junc files listed in test_juncfiles....
3
votes
0answers
44 views

How to assign the best gap penalty and gap extension penalty using BLOSUM65

For an assignment I must do a pairwise optimal local alignment using BLOSUM65 and five protein sequences. The algorithm I want to use is the Smith-Waterman. Context protein sequencing using Blastp: ...
2
votes
1answer
75 views

Aligning sequence and comparing it against primer

I am looking to show how a primer is consistent among some genomic data. I have a primer of about 23bp and looking to compare it to about 5000 genomic sequences of 10kb. I am unsure how to format it ...
0
votes
1answer
68 views

Find a map/correspondence between two versions of a genome

I am working with two versions of the C. elegans genome. I am finding interesting regions (specifically, tRNA genes) in version 1 and then I would like to know if version 2 also has a tRNA gene in ...
1
vote
0answers
84 views

How to make year scale bar unit in figtree software?

I have generated phylogenetic trees for virus sequences by using beast software. I observed in various research articles that the phylogentic trees also have a scale-bar (which mostly represents ...
2
votes
0answers
24 views

Alignment using secondary and tertiary features of DNA

I m trying to align different sequences of length not greater than 50. Is there any way to incorporate other information such as stacking energy, entropy, bonds etc. If there any way to align ...
4
votes
0answers
76 views

Merging ssu-align alignments

ssu-align is an HMM-based MSA tool for ribosome's small subunit (SSU) sequences. It's bundled with three SSU models: archaeal, bacterial and eukaryotic. Given a set of archaeal and bacterial sequences ...
8
votes
1answer
262 views

Better aligner than bowtie2?

Bowtie2 is probably the most widely used aligner because of it's speed. Burrow-wheeler (BW) algorithms (including bwa) tend to ...
1
vote
1answer
52 views

Interpreting bayesian phylogenetic model using Tracer?

I am doing phylodynamic analysis of virus sequences using bayesian method using BEAUti and BEAST. As a part of my analysis I am using Tracer to check how my model is working. I can interpret some of ...
6
votes
1answer
61 views

Why aren't clustal alignments stable under deletion of some of the sequences?

I'm new to pairwise and multiple sequence alignment in general, but I thought I understood how clustal works -- k-tuple distance is a cheap metric that's 'probably approximately' monotonic in the real ...
8
votes
2answers
146 views

Is there a standard definition for “assembly polishing”?

Is there a standard definition for "assembly polishing" in the field? Is there a standard definition for what polishing algorithms do? My understanding of "polishing" is strongly influenced by ...
5
votes
1answer
194 views

BLAST(n): No hits found

I am currently exploring the BLAST program, just for testing purpose i generated two FASTA files, containing two genes A and B, such that B is just a motif of repeated 'G's that occurs in A. file A....
1
vote
0answers
46 views

Mugsy error: Can't find species II dna at output/software/mugsy_x86-64-v1r2.3/mugsy line 501

I have installed mugsy in order to create a multiple genome alignment and a phylogenetic tree of several species of nematodes. The following command successfully pulls out the help: ...
5
votes
1answer
78 views

Are there certain alignment methods/tools which perform better with a high density of indels?

I have a set of experiments which should result in WGS reads with a high density of indels. Question: Are there certain alignment tools/methods which perform respectively "better" with these reads? ...
1
vote
0answers
67 views

igv_plotter error: Xvfb did not start

I am trying to get screenshots from alignments of reads to a genome in IGV (Integrated Genome Viewer) using igv_plotter. ...
-1
votes
1answer
95 views

Command not found error on HISAT2

I have been attempting to map reads to a reference genome using HISAT2 using the Pertea, et al 2016 Nature Protocols paper. I am able to successfully generate an index (using the hisat2-build command),...
5
votes
1answer
103 views

Evaluate clusters of individuals by using their sequence data

For a dataset of several hundred individuals, I applied a hierarchical clustering to generate clusters based on a functional trait that sets them apart. My task is now to evaluate if these clusters ...
1
vote
1answer
78 views

Creating frequency plot from weblogo with frequency unit on the Y axis

Hello I am trying to create frequency plot for a motif with frequency unit on the Y axis from 0 -100 nt as the unit as represented in this paper.(Seiler et al., 2018)
6
votes
1answer
75 views

Does the DNA or RNA of some ethnic groups map better than others' to the human reference genome sequence?

I believe that the human genome reference took DNA samples from different people and that some natural variation is included in extra contigs. However, the human reference genome comes from a ...
5
votes
3answers
193 views

Generating the reconstructed alignment from BAM

I have a (small) BAM file with CIGAR and MD fields. Question 1: What tools exists in Python and/or R to reconstruct the alignment between the reference and the read in a BAM? Given that this is a ...
2
votes
1answer
116 views

Can I export the SNPs between whole genome alignments using the command line?

I am using Mauve to align two whole genomes. I use the following command to get the alignment in xmfa format: ...
0
votes
1answer
68 views
3
votes
1answer
519 views

Can I index a compressed FASTA file using STAR?

I am using STAR to align RNA-seq reads to a reference genome. Before the alignment, I need to generate an index of the reference genome. I use the following code to generate the index successfully: <...
2
votes
2answers
123 views

How to read .bwt file .sa file?

In BWA project in bwt.c file I found bwt_dump_bwt method and bwt_dump_sa method. I want to use them to read .bwt file and .sa file. I wrote the following program: ...
1
vote
2answers
164 views

How BWA generate index files?

I need to know how BWA generate bw and sa in less memory usage ? Do they save all rotations temporary ? I need to know do BWA stores all rotations so that it can sort the rotations alphabetically ? ...
2
votes
1answer
113 views

Generating burrows-wheeler-transform and a suffix array of a DNA sequence with less memory

Also posted on biostars After indexing bwa index -a bwtsw reference.fa I got files. like .bwt file and .sa file. The naive way of generating these file is:   ...
4
votes
2answers
62 views

How does Li and Durbin's BWA paper compare alignment programs on real data?

Li and Durbin's "Fast and accurate short read alignment with burrows-whleeler transform" found here, says: We evaluate the performance of BWA on ... real paired-end data by checking the fraction ...
1
vote
1answer
21 views

Why does RATT create a directory with chromosome sequences and how can I stop it?

I have run RATT to transfer the annotation from a reference strain to another strain. For this, I have run: ...
2
votes
1answer
78 views

How to generate a weblogo image that takes into account sequence frequencies?

I have a large aligned amino acid sequences file (fasta file) from next generation sequencing data. The unique sequences have been aligned but these all have certain read counts (frequencies ...
1
vote
2answers
39 views

Mapping bisulfite reads to a reduced size genome

Is it worth mapping bisulfite reads (WGBS) to a reduced size genome? I'm interested only in modifications in CpG context, thus instead of mapping to a whole genome (human genome) I would: Extract ...