Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
0
votes
1answer
30 views

MemoryError w/ matrix | Smith-Waterman Algorithm Python

I am implementing my own version of the Smith-Waterman algorithm. This works perfectly fine with 2 genomes of 100 chars each. However, I want to run this ...
-2
votes
0answers
29 views

How to search reads including target gene from raw sequencing dataset?

I want to get all reads related to one target gene from thousands of raw reads dataset(fastq). Mapping reads onto genome is time consuming and computationally expensive. Currently, I converted reads ...
1
vote
1answer
37 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
0
votes
1answer
6 views

Understanding ViennaRNA RNAdistance scoring table

I'm trying to compare the output of 2 different algorithms of RNA structure prediction (my implementation of Nussinov vs RNA-mfold algorithm) using the RNAdistance algorithm that is part of ViennaRNA ...
1
vote
0answers
31 views

Combine two alleles to genotype locus?

I have a following fasta (produced by stacks populations): ...
2
votes
1answer
70 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
2
votes
2answers
41 views

Calculate genome coverage and depth from alignment

I have a .bam alignment file and a genome reference .fasta file. I am looking for a easy to use tool (that I can reference in a publication) to calculate the percentage coverage of the reference by ...
0
votes
1answer
18 views

How can I get bedtools to tell me which genes are being expressed?

I'm trying to align the Acinetobacter baumanii genome to a genome. I've already done the alignment, and I want to use bedtools to see which genes are being expressed exactly. When I try running the ...
1
vote
1answer
42 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
0
votes
0answers
19 views

going from probe sequence to hgnc gene symbol

I have a bunch of (human) Agilent probes (both probe ID and the actual sequence, some custom array), and I would like to get the hgnc gene symbol based on the actual probe sequences, rather than the ...
0
votes
0answers
33 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
1
vote
0answers
27 views

Global alignment between two sequence X and Y with maximum number of identical matches

If 2 protein sequence X of length m and Y of length n and if there are several highest scoring global alignments, then I want to get one alignment that has largest number of columns in which a letter ...
0
votes
0answers
21 views

How to read E-value annotation on NCBI BLAST?

i am a bit confused how to read the current E value annotation on NCBI BLAST results. I looked into the matter but could not find an factual answer . What i understood so far: E -values are the ...
0
votes
0answers
19 views

Trouble aligning next generation sequencing data to reference genomes using QuasR package in Bioconductor. Cannot import .txt

I'm trying to check the quality of my paired end read sequencing data. I am following this pipeline (https://f1000research.com/articles/4-1062#ref-21) which uses QuasR in the first step. My list of ...
-3
votes
1answer
37 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
3
votes
1answer
43 views

Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the ...
0
votes
1answer
62 views

How does one convert a log-likelihood substitution matrix into a probability matrix?

I am trying to calculate the substitution probabilities for amino acids (i.e. the probability of one amino acid given another). In theory, you should be able to derive them from a log-likelihood ...
0
votes
0answers
20 views

How to assess how prone genes may be to acquire structural polymorphisms?

I have 5 strains of P.falciparum. Each FASTA file has all its annotated CDSs. After a first pre-processing phase, where I eliminated the strangest sequences (perhaps the longest or shorter ones, which ...
1
vote
0answers
18 views

TCGA dataset: different accession IDs mapped to same location?

I'm currently working on TCGA miRNA dataset. After constructing a reads matrix, I'm trying to find the isoform sequence. In my data, I have the genomic location (isoform_coords). I found that entries ...
0
votes
2answers
107 views

Why GAG protein HIV-1 (virus) is in Staphylococcus sp. SS21 and in Klebsiella quasipneumoniae (Bacteria)?

I am one ignorant... Why GAG protein HIV-1 (virus) is in Staphylococcus sp. SS21 and in Klebsiella quasipneumoniae (Bacteria)? These are the links in GenBank: ...
1
vote
0answers
42 views

Prokka error message

I am trying to run Prokka but the following error message appears: Could not run command: makeblastdb -hash_index -dbtype prot -in /cluster/software/prokka/1.13.7-gompi-2019a/db/kingdom/Archaea/sprot ...
0
votes
1answer
53 views

Align the HIV-1 Gag protein with the Gag protein of Visna virus

Align the HIV-1 Gag protein with the Gag protein of Visna virus Background Visna virus is a lentivirus causing encephalitis in sheep The problem is align the follow two protein Gag of viruses HIV-1 (...
0
votes
0answers
38 views

Identify novel protein using Resfam

I am doing a functional metagenomic study. I did the annotation of protein sequences using HMMER against the Resfam database*. The publication is here As a result from the Resfam, I have a list of ...
0
votes
1answer
38 views

What is the best way to map/align my reads on a given genome?

I am frequently using a ballgown package for my rnaseq analysis, but recently I have had a new task to have my reads mapped on two different genomes to understand the level of alignment between the ...
0
votes
0answers
19 views

Where to find online resource to align sequences?

I have two protein sets from P.cynomolgi coming from two different geographical areas. One with n (without being too specific) and the other with q proteins.In the matlab environment I build a matrix ...
0
votes
0answers
31 views

Pairwise alignment using CIGAR String

I want to perform pairwise alignment and get the resulting CIGAR string. The channel can emit insertions, deletions and substitution errors. For example, if the input was AAGCT Then the output could ...
0
votes
0answers
23 views

DNA sequence error annotation

Suppose I generate a DNA sequence of the following pattern. AAGTC And after being passed through a channel with insertion, deletion and substitution errors obtain the following sequence AAAGGC Where ...
0
votes
0answers
10 views

How to annotate ChIP peaks base on NCBI sequence name?

I have chip-seq peaks based on NCBI genome which looks like the following: ...
1
vote
2answers
40 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
1
vote
1answer
30 views

mRNA cap identification by sequencing?

If you sequence a positive-sense RNA virus genome using NGS via Nanopore, Illumina or even the old Sanger method, is it possible to tell if the virus has 5' (five prime) cap at the 5' end of the RNA ...
0
votes
0answers
36 views

Best way to align to find inserted sequence

We have some RNA from knock-in mice, there are two different sequences we're looking for. We have aligned to the mouse genome using STAR but the sequence isn't there which isn't too surprising What is ...
1
vote
2answers
158 views

Are codons in RNA layered? Are we misinterpreting RNA codons?

I am analyzing nucleotide base-pair patterns in RNA and DNA, and had a thought about RNA and DNA (Let me first state though, I am not a biologist; I am an algorithmatician, employing a sort of ...
0
votes
1answer
48 views

How to find adapter sequence

I have this GSE dataset ( GSE104279 ) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104279) I want to run cutadapt, but how would I find the adapter sequence so I can run cutadapt?
0
votes
1answer
28 views

Get list of urls of GSM data set of a GSE set

I have this GSE dataset ( GSE104279 ) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104279). I want to make a table with set IDs and ftp urls to use it as a table in galaxy.org I know that we ...
1
vote
0answers
25 views

Fastq dataset after clustering

I'm doing a project for DNA archival storage systems Is there an open-source dataset used as ground truth for clustering? E.g A file containing the ground truth strand sequences, which have been ...
0
votes
0answers
36 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
2
votes
2answers
56 views

Filtering out reads from a reference (e.g. rRNA) using bowtie2

As I understand it, bowtie2 can easily be used to split reads into one of two groups: reads for which both of a pair align well to a reference (using e.g. ...
1
vote
0answers
26 views

Filtering pileup from site lists

I want to write a script that filters a pileup file from a site lists file. As an input I get a reference genome, pileup and site lists files. Example of an output for this script: Pileup File : ...
1
vote
1answer
48 views

How does sequence alignment help with protein folding prediction? [closed]

I've been seeing using sequence alignment to help with prediction of protein folding, but am unable to understand why. Google returns other research papers for these search terms, hence I'm hoping the ...
0
votes
0answers
20 views

Extract Illumina reads that match with respect to their coordinates on the genome from fastq files

I want to use BPP to estimate divergence times and population sizes of a set of species. I have a vcf file with SNPs called from RADseq. The problem is that BPP uses the multi-species coalescent model ...
0
votes
0answers
28 views

Why do I get cytosine to guanine/adenine transitions in bisulphite treated sequences?

I got my sequencing results (bisulphite treated and non treated sequences of same species Allium cepa) and now I have to do analysis in Cymate online tool. I prepared all sequences as it is written in ...
0
votes
0answers
16 views

Blast templates not found in PSI-TM Coffee

I'm trying to run psicoffe mode on Ubuntu 18.04, but it returns the error: 17633 -- WARNING: Impossible to find BLAST Templates Check that your blast server is properly installed [See documentation][...
0
votes
0answers
59 views

workaround for error: Bad CPU type in executable c

I use clustal() from library ape every now and then, but now it doesnt work... code: sylvia.clus = clustal(sylvia.seq) Error: ...
0
votes
1answer
18 views

Installation of PRANK MSA in WLS Ubuntu 20.04 LTS

I want to install PRANK on the Windows 10 Linux subsystem (Ubuntu 20.04 LTS), I have followed the installation instructions to no avail. ...
1
vote
1answer
50 views

How to understand methylation level?

For Bisulfite Sequencing data, we can calculate methylation level for a specific locus, $$ \mbox{methylation level} = \frac{\mbox{# methelyated reads}}{\mbox{# total reads}} $$ Here I think, for this ...
1
vote
0answers
23 views

What are the symbols of $*$ and '$\_$' in an unknown alignment format for HLA data from the IMGT dataset?

Has anyone worked with the IMGT HLA database/dataset before? IMGT-HLA git repo they have some convenient text files (eg. link to gene A .txt file) with the genomic data for the different alleles of ...
2
votes
1answer
45 views

mBED has time complexity $O(n \lg n)$, claimed by Clustal Omega paper, why?

In the Clustal Omega paper, it says the following about mBED ($N$ is the number of input sequences, I assume): we use a modified version of mBed (Blackshields et al , 2010), which has complexity of $...
0
votes
1answer
34 views

Display a score or graph to visualize the degree of conservation of each residue from alignment data

I would like to display a score or graph to visualize the degree of conservation of each residue from the amino acid alignment data. If possible, I'd like to extract the parts of the game that scored ...
1
vote
1answer
31 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...

1
2 3 4 5