Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
1
vote
0answers
25 views

How to modify dot plot in MUMmer 3 for bacteria comparative genomics?

I was trying to make a dotplot to visualize genome-genome sequence alignment by using the MUMmer 3 software (it is typically used to compare whole genome sequences of bacteria). I runned the same ...
2
votes
2answers
43 views

What is the file .mums created by mummer?

I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I did are: 1.create a file .mums with the following command line: ...
4
votes
1answer
40 views

How do you convert Raw Alignment Score to Bit Score?

I'm coding a pipeline where I make a lot of pairwise alignments, and I end up with raw alignment scores. But, I really need to look at my results in terms of bit scores. I know that the formula is: $𝑆...
0
votes
1answer
25 views

Smith-Waterman traceback with large gaps

I am currently trying to understand how the traceback algorithm is supposed to work for the smith-waterman algorithm as my current understanding breaks down in case of a large alignment gap. Assume ...
2
votes
1answer
24 views

Python package or CLI tool outputting mutations of sequence with respect to reference

I'm new to bioinformatics, and I'm looking for a tool that takes two FASTA files, one containing a reference, let's call it A.fasta, the other another sequence, let'...
1
vote
1answer
47 views

fastq file format unknown

I have paired-end fastq files some of which seem to be in a weird format (from a collaborator, not a public database). When I cat the file I get what seem to me to ...
2
votes
1answer
44 views

Get Salmon mapping/alignment summary

With HISAT2, after the alignment of fastq files you get an alignment summary like this: ...
1
vote
1answer
28 views

Differentiating molecules based on peptide sequence? How to annotate?

I want to differentiate between classical class I and non classical class I MHC molecules in a model organism using well conserved structural features within classical MHC I molecules (eg intradomain ...
1
vote
1answer
21 views

Alignment to verify plasmid from forward and reverse Sanger sequencing reads

I am analyzing Sanger sequencing data to verify whether or not the correct protein coding sequence was inserted during cloning. For each sample, I have both forward and reverse Sanger sequencing reads ...
1
vote
0answers
48 views

Alignment tools on desktop for peptide alignment sequence and how to make annotations on alignments look presentable?

I have 10 transcripts where I need to do 5 peptide sequence alignments (2 transcripts per alignment). I need to do this in order to indicate which amino acids lead to which domains. My questions are ...
3
votes
1answer
35 views

Finding 2000 bp sequences that occur more than once in the genome

I am looking for a software that can identify long sequences (1500-2000 bp) that occur more than once in my genome of interest. A k-mer counter like KMC could have worked, but KMC has a max limit of ...
1
vote
1answer
54 views

What is the meaning of split read?

I want to use rna seq data to later perform functional tests on fusion genes. so before that I need to filter the "best results" (of rnaseq) for deciding which candidates I actually want to ...
2
votes
2answers
60 views

Sequence allignment with suffix array?

I'm writing the code from scratch and not using libraries for the actual indexing/search since it's a project for school. Any blackbox advice is fairly useless. I'm planning on aligning some short ...
1
vote
1answer
39 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
1
vote
1answer
18 views

Understanding ViennaRNA RNAdistance scoring table

I'm trying to compare the output of 2 different algorithms of RNA structure prediction (my implementation of Nussinov vs RNA-mfold algorithm) using the RNAdistance algorithm that is part of ViennaRNA ...
1
vote
0answers
31 views

Combine two alleles to genotype locus?

I have a following fasta (produced by stacks populations): ...
2
votes
1answer
75 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
2
votes
2answers
67 views

Calculate genome coverage and depth from alignment

I have a .bam alignment file and a genome reference .fasta file. I am looking for a easy to use tool (that I can reference in a publication) to calculate the percentage coverage of the reference by ...
0
votes
1answer
22 views

How can I get bedtools to tell me which genes are being expressed?

I'm trying to align the Acinetobacter baumanii genome to a genome. I've already done the alignment, and I want to use bedtools to see which genes are being expressed exactly. When I try running the ...
1
vote
1answer
49 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
0
votes
0answers
21 views

going from probe sequence to hgnc gene symbol

I have a bunch of (human) Agilent probes (both probe ID and the actual sequence, some custom array), and I would like to get the hgnc gene symbol based on the actual probe sequences, rather than the ...
1
vote
1answer
42 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
2
votes
1answer
50 views

Global alignment between two sequence X and Y with maximum number of identical matches

If 2 protein sequence X of length m and Y of length n and if there are several highest scoring global alignments, then I want to get one alignment that has largest number of columns in which a letter ...
0
votes
0answers
29 views

How to read E-value annotation on NCBI BLAST?

i am a bit confused how to read the current E value annotation on NCBI BLAST results. I looked into the matter but could not find an factual answer . What i understood so far: E -values are the ...
0
votes
0answers
20 views

Trouble aligning next generation sequencing data to reference genomes using QuasR package in Bioconductor. Cannot import .txt

I'm trying to check the quality of my paired end read sequencing data. I am following this pipeline (https://f1000research.com/articles/4-1062#ref-21) which uses QuasR in the first step. My list of ...
-3
votes
1answer
38 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
4
votes
1answer
52 views

Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the ...
0
votes
1answer
66 views

How does one convert a log-likelihood substitution matrix into a probability matrix?

I am trying to calculate the substitution probabilities for amino acids (i.e. the probability of one amino acid given another). In theory, you should be able to derive them from a log-likelihood ...
0
votes
0answers
20 views

How to assess how prone genes may be to acquire structural polymorphisms?

I have 5 strains of P.falciparum. Each FASTA file has all its annotated CDSs. After a first pre-processing phase, where I eliminated the strangest sequences (perhaps the longest or shorter ones, which ...
1
vote
0answers
18 views

TCGA dataset: different accession IDs mapped to same location?

I'm currently working on TCGA miRNA dataset. After constructing a reads matrix, I'm trying to find the isoform sequence. In my data, I have the genomic location (isoform_coords). I found that entries ...
0
votes
2answers
107 views

Why GAG protein HIV-1 (virus) is in Staphylococcus sp. SS21 and in Klebsiella quasipneumoniae (Bacteria)?

I am one ignorant... Why GAG protein HIV-1 (virus) is in Staphylococcus sp. SS21 and in Klebsiella quasipneumoniae (Bacteria)? These are the links in GenBank: ...
1
vote
0answers
75 views

Prokka error message

I am trying to run Prokka but the following error message appears: Could not run command: makeblastdb -hash_index -dbtype prot -in /cluster/software/prokka/1.13.7-gompi-2019a/db/kingdom/Archaea/sprot ...
0
votes
1answer
54 views

Align the HIV-1 Gag protein with the Gag protein of Visna virus

Align the HIV-1 Gag protein with the Gag protein of Visna virus Background Visna virus is a lentivirus causing encephalitis in sheep The problem is align the follow two protein Gag of viruses HIV-1 (...
0
votes
0answers
56 views

Identify novel protein using Resfam

I am doing a functional metagenomic study. I did the annotation of protein sequences using HMMER against the Resfam database*. The publication is here As a result from the Resfam, I have a list of ...
0
votes
1answer
39 views

What is the best way to map/align my reads on a given genome?

I am frequently using a ballgown package for my rnaseq analysis, but recently I have had a new task to have my reads mapped on two different genomes to understand the level of alignment between the ...
0
votes
0answers
19 views

Where to find online resource to align sequences?

I have two protein sets from P.cynomolgi coming from two different geographical areas. One with n (without being too specific) and the other with q proteins.In the matlab environment I build a matrix ...
0
votes
0answers
39 views

Pairwise alignment using CIGAR String

I want to perform pairwise alignment and get the resulting CIGAR string. The channel can emit insertions, deletions and substitution errors. For example, if the input was AAGCT Then the output could ...
0
votes
0answers
23 views

DNA sequence error annotation

Suppose I generate a DNA sequence of the following pattern. AAGTC And after being passed through a channel with insertion, deletion and substitution errors obtain the following sequence AAAGGC Where ...
0
votes
0answers
10 views

How to annotate ChIP peaks base on NCBI sequence name?

I have chip-seq peaks based on NCBI genome which looks like the following: ...
1
vote
2answers
40 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
2
votes
2answers
48 views

mRNA cap identification by sequencing?

If you sequence a positive-sense RNA virus genome using NGS via Nanopore, Illumina or even the old Sanger method, is it possible to tell if the virus has 5' (five prime) cap at the 5' end of the RNA ...
0
votes
0answers
39 views

Best way to align to find inserted sequence

We have some RNA from knock-in mice, there are two different sequences we're looking for. We have aligned to the mouse genome using STAR but the sequence isn't there which isn't too surprising What is ...
1
vote
2answers
159 views

Are codons in RNA layered? Are we misinterpreting RNA codons?

I am analyzing nucleotide base-pair patterns in RNA and DNA, and had a thought about RNA and DNA (Let me first state though, I am not a biologist; I am an algorithmatician, employing a sort of ...
0
votes
1answer
66 views

How to find adapter sequence

I have this GSE dataset ( GSE104279 ) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104279) I want to run cutadapt, but how would I find the adapter sequence so I can run cutadapt?
0
votes
1answer
38 views

Get list of urls of GSM data set of a GSE set

I have this GSE dataset ( GSE104279 ) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104279). I want to make a table with set IDs and ftp urls to use it as a table in galaxy.org I know that we ...
1
vote
0answers
26 views

Fastq dataset after clustering

I'm doing a project for DNA archival storage systems Is there an open-source dataset used as ground truth for clustering? E.g A file containing the ground truth strand sequences, which have been ...
0
votes
0answers
36 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
2
votes
2answers
88 views

Filtering out reads from a reference (e.g. rRNA) using bowtie2

As I understand it, bowtie2 can easily be used to split reads into one of two groups: reads for which both of a pair align well to a reference (using e.g. ...
1
vote
0answers
28 views

Filtering pileup from site lists

I want to write a script that filters a pileup file from a site lists file. As an input I get a reference genome, pileup and site lists files. Example of an output for this script: Pileup File : ...

1
2 3 4 5