Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
0
votes
0answers
5 views

Finding simple sequence from reads with significant overlap

I wrote a script to pull out reads from a huge fastq file in an iterative manner, by finding homology to the previous sequence. It seems like it should be relatively easy to overlap them and ...
0
votes
0answers
36 views

what is the best option for genomic analysis? [closed]

It is best to work with PowerShell, shell script, Pycharm or R for analysis and alignment with Python and R programming language, focusing on genomic analysis, CDS (statistical analysis, database) ...
2
votes
0answers
35 views

Is there a modern alignment tool tailored for transmembrane regions?

I am looking for a project or tool that allows programmatic pairwise alignments of proteins but that takes care with transmembrane regions of proteins. TM regions are traditionally too information ...
0
votes
1answer
33 views

how to calculate Pairwise Alignment Scores for blosum62

I have a bioinformatics exam coming up. I can understand the difference between the global algorithm and the local algorithm, but I have a problem with gap opening penalty and gap extension penalty. ...
1
vote
1answer
37 views

What do the symbols mean in minimap2's gap cost equation?

Heng Li's paper on minimap2 is understandable to me right up until the moment that it gives this definition of gap cost: 2.2.1 Alignment with 2-piece affine gap cost Minimap2 performs DP-based ...
2
votes
2answers
72 views

Is there any way to align ChIP-seq reads to telomeres?

I know that telomeres are highly repeated sequences, but is there any way to retain any reads that map to these regions (on HG38)? I recently managed to find some protein binding to centromeres, ...
1
vote
2answers
42 views

Smith-Waterman Pairwise Local Alignment Algorithm

I have written a R code for Smith-Waterman (SW) algorithm. I wanted to check the results of my code with online examples. In all cases -except one- I found the same alignment. So there is this one ...
1
vote
1answer
54 views

Best way to “fish” long reads that match a query sequence

Very simple set-up: We have a PacBio long high-fidelity (HiFi) reads, genome sequencing, and some of those that contain a particular sequence. I want to find out which ones. The length of the query ...
0
votes
2answers
36 views

Inferring a phylogenetic tree from BLASTn

I am trying to infer a phylogenetic tree from a Blastn output and from what I have understood, what I should do is 1) extract the alignments and re-align them using Muscle, then 2) feed the .aln file ...
1
vote
0answers
12 views

How to get a tabular summary from srspair alignment file?

I checked EMBOSS but there is no tabular output for pairwise alignment. I can write a script but would like to know if there is already a tool to summarize an alignment in srspair format in the form ...
0
votes
1answer
71 views

How to reproduce this specific sequence logo from 10 000 human mRNAs?

this is A sequence logo showing the most conserved bases around the initiation codon from 10000 human mRNAs. I would like to reproduce this sequence logo. How can I get the sequences? which database ...
0
votes
0answers
29 views

BLAST server download

I discovered that Phytozome's BLAST results look quite nice (please see below). By any chance, does anyone know where to download this BLAST server in order to install it locally for organisms which ...
1
vote
1answer
45 views

what does a sequence look like before alignment?

I am confused with Sequence alignment, which is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, ...
1
vote
1answer
135 views

How to compute the Shannon entropy for a strand of DNA?

I'm confused by the computation of sequence logo. Wikipedia gives a process about this without a concrete example. Let's just consider DNA, so there are 4 bases (nucleic acids). The following data ...
1
vote
1answer
82 views

Why do ten rows (Figure_1) correspond to 2 bits (Figure_2) in a sequence logo?

Following this question, I'm confused with the computation of sequence logo Following data comes from the book "Machine Learning - A Probabilistic Perspective (Figure_1)" here is the corresponding ...
1
vote
1answer
147 views

What is “aligned sequences” and “consensus sequence” in the context of sequence logo? How to compute these?

In bioinformatics, a sequence logo is a graphical representation of the sequence conservation of nucleotides (in a strand of DNA/RNA) or amino acids (in protein sequences). so, What is "aligned ...
2
votes
1answer
43 views

For phylogenetic tree construction from core-genome which one is preferable: amino-acid based MSA or nucleotide based MSA?

The genomes are from same species. Is it true that, in phylogenetic tree constructed from amino-acid based MSA (multiple sequence alignment) some information are lost, so for phylogenetic ...
2
votes
0answers
83 views

How to get a MSA fasta from BAM/SAM?

I am working with paired end NGS miseq data from a viral genome with multiple timepoints. I have filtered and trimmed this data for quality and adapter sequences. I have then merged the filtered ...
0
votes
1answer
54 views

Differences in webtool and standalone Clustal Omega Percent Identity Matrix

I'm trying to align sequences using MUSCLE in my own computer. To compute Percent Identity Matrix I'm trying to use Clustal2.1 like it's done in https://www.ebi.ac.uk/Tools/msa/muscle/. Even though I'...
3
votes
1answer
60 views

Produce a single sequential FASTA sequence out of BAM

I'm having problems properly looking for a solution because I'm a layman in Bioinformatics not familiar with the terminology. I'm hoping you can nudge me in the right direction, please! Thank you very ...
1
vote
2answers
40 views

Global or local alignment on sequences for which it is assumed that they have common ancestry

As the title says I would like to know which alignment method(global or local) should I use for sequences for which is assumed that they have common ancestry? The sequences are 21 aa long peptide ...
1
vote
1answer
95 views

A GTF annotation for GRCH375d version

I have been given a bunch of .bam files, that come from the alignment on GRCh37d5 of human genome by Star tool. I want to extract raw read counts from these bam files by FEATURECOUNTS tool so I need a ...
5
votes
1answer
75 views

Is there a way to assemble contigs starting from a specific sequence?

My work involves searching for marker genes/fragments in metagenomic databases (like the Sequence Read Archive). Once I find these sequences, I would like to know more about the neighboring genomic ...
0
votes
1answer
26 views

How to find the position-specific weight matrix (PSWM) for a list of genes having different sizes?

Wiki has the algorithm for finding position-specific weight matrix (PSWM) for a list of nucleotide sequences having an equal number of nucleotide. How do we find the PSSM for a list of nucleotide ...
4
votes
2answers
104 views

How to predict stop codons in Illumina reads?

I have Illumina MiSeq paired-end reads from 150bp amplicons mapped to my reference genome (> 1000X coverage). These reads have indels that may or may not induce frameshifts. If the indel induces a ...
6
votes
2answers
418 views

Definition of “seed” in sequence alignment

I would like to know what is meant by "seed" for various sequence aligners. How is it important?
0
votes
1answer
10 views

Empty .result in MirDeep Star

I am using MirDeep star tool for RNA sequence alignment. I have tried both GUI version and command line version of this tool. But every time, I am getting empty . result file and .known_mir file. This ...
1
vote
0answers
150 views

Aligning nucleotide sequences in APE software

I am very new to APE software. I am trying to align complementary oligo-DNA strands using APE on macOS. I have both the forward and reverse sequence of an oligo-DNA insert in two separate files. But I ...
3
votes
3answers
96 views

Alignment with arbitrary number of mismatches or gaps

I have 23bp long reads and want to find all possible alignments of them to the human genome (hg19, hg38) for an arbitrary number of mismatches (<7), possibly also small indels. I've read in ...
4
votes
3answers
737 views

How to get fasta alignment file from SAM/BAM file?

I am not talking about consensus sequence, I know how to get consensus sequence using mpileup in samtools/bcftools. As I understand , SAM/BAM files are basically sequence alignment format so it's ...
4
votes
1answer
373 views

Why do I get so many insertions from Minimap2 on my Nanopore WGS?

I'm a starting my analysis on nanopore whole genome sequencing. I start my analysis from this popular Github. The sample I downloaded was WGS for NA12878, so I would assume it's alignment to GRCh38 ...
2
votes
2answers
596 views

Hardware Requirements (specs) for Bioinformatics-dedicated desktop [closed]

I know this is a somewhat general or vague question, but I’m interested in your opinions. I must build a desktop for general bioinformatics activities with human genomes. I will work with Python and R ...
3
votes
1answer
41 views

Seeking explanation of the hg38 files downloaded from bowtie 2 website

I downloaded the H. sapiens, NCBI GRCh38 files from Bowtie's website. After unzipping, there are 6 files, 4 that end in set 1.ebwt, set2.ebwt, set3.ebwt, and set4.ebwt and two that end in set.rev.1....
3
votes
1answer
41 views

Restricting match output for multiple sequence alignment using mafft?

So I aligned roughly 5k sequences and I got my output using mafft. However, I want to restrict the output to only present conserved segments of a specific length (let's say 25bp). Does mafft have ...
7
votes
2answers
175 views

How to check if indels in VCF files are left or right aligned?

I downloaded a VCF file from dbSNP, and I'm curious if the indels in the file are left-aligned for GRCH37 genome. The documentation doesn't say anything. How can we tell if a VCF file has left or ...
4
votes
1answer
168 views

Can blat use more than one core/CPU to speed up the alignment?

I am using BLAT to align two versions of the genome of C. elegans. I can see in the Activity Monitor of my Mac Book Pro High Sierra that blat is using 100% of a CPU....
6
votes
1answer
155 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
5
votes
6answers
362 views

Identifying Indels from Chromatograms

I have around 100 chromatograms (.ab1 files) from Sanger sequencing a genome at loci believed to have an indel. I'm new to interpreting this kind of data in ...
2
votes
3answers
468 views

How BLOSUM Matrix is constructed and calculated

I would like to ask how BLOSUM matrix is constructed and calculated ? I read the wikipedia and I still do not understand it. I do not understand the mathematical calculations as I have low knowledge ...
5
votes
1answer
269 views

Understanding the initialization of the Needleman-Wunsch algorithm

I would like to ask why when we initialize 0 as the starting point, there are 3 gray boxes that are not used as shown (highlighted in the red box) in the pic? Are these boxes to show that they are ...
5
votes
1answer
179 views

How to output all sequences with bwa mem, not `*`?

I've been running bwa mem -a for alignment, using the -a flag---this will output all alignments for SE or unpaired PE I've ...
7
votes
4answers
992 views

What is a simple command line tool for doing Needleman-Wunsch pair-wise alignment on the command line

I have two DNA strings: GGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGC and AGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGG I want a tool that allows me to do something like this on the ...
4
votes
5answers
288 views

Fast and reliable alternatives to blast

After some unexpected results (and previously reported) I heard that there are other tools for finding similar sequences besides blast that are faster and more accurate. I only found hmmer, but I don'...
5
votes
1answer
220 views

Does the “.full.aln” file produced by snippy-core contain all bases of my input sequences aligned to the reference genome?

I have a number of sequences and a reference genome. I used snippy to align each individual sequence with the reference genome. I then used ...
5
votes
2answers
260 views

full visualisation of draft genomes alignment

I have two draft genomes (aprox. 500Mb each), one with ~10'000 scaffolds (genome1.fasta) and one with ~1'000 contigs (...
0
votes
1answer
34 views

Exporting nt's differences from MEGA alignment

I have an alignment of some full genome sequences of DENV1 that we have recently sequenced from the serum of patients. I have already cleaned the sequences, built the alignments and done the SNPs ...
3
votes
0answers
95 views

Sequence alignment using BWT

My Problem: Skipping some specific background, what I want to do is judging whether some soft-clipping sequences are the same, which may result by the same SV event. Colored bases in Fig.1 is an ...
1
vote
0answers
123 views

How to create a dendrogram of clusters and reconstruct phylogenetic relationship

I'm working with a Daphnia data set looking at the 16s gene pulled from the BOLD database. So far I did a multiple sequence alignment and attempted to cluster and plot a dendrogram: ...
6
votes
1answer
772 views

What are “split reads” and “intron clusters?”

I'm working through the example data set for LeafCutter and the documentation mentions "split reads": This will cluster together the introns fond [sic] in the junc files listed in test_juncfiles....
3
votes
0answers
77 views

How to assign the best gap penalty and gap extension penalty using BLOSUM65

For an assignment I must do a pairwise optimal local alignment using BLOSUM65 and five protein sequences. The algorithm I want to use is the Smith-Waterman. Context protein sequencing using Blastp: ...