Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
1
vote
0answers
6 views

PSSM Matrix in PSI-BLAST

After running PSI-BLAST one obtains a profile matrix with this header: A R N D C Q E G H I L K M F P S T W Y V How does PSI-...
-1
votes
2answers
41 views

ClustalOmega alignment

I am performing multiple sequence alignment using Clustal Omega for 600 RNA covid-sequences, i.e. cDNA on Genbank, with input characters around 30574 characters for each sequence. I am running it on ...
0
votes
2answers
59 views

What is the most appropriate way to find the most recent common ancestor between two distantly related species

I want to specifically find the common ancestor between a lobster and a humans. I suspect it was an aquatic worm of some description. But I want to know about the nervous system of this common ...
1
vote
2answers
92 views

Help with MinION sequencing data species identification

Hi I'm new to bioinformatics and have just completed my first run on the MinION (long read sequencing Oxford Nanopore Technologies). I was hoping someone could direct me towards R packages, workflow, ...
0
votes
0answers
11 views

Why does Nucmer Genome alignment produce faulty Dot plot?

I am using Mummer v.3.23 to make a dot plot between two genomes of the same species. One genome was assembled using PacBio and one from Dovetail. None of them is ...
1
vote
0answers
20 views

MarkDuplicatesSpark failing with cryptic error message. MarkDuplicates succeeds

I have been trying to follow the GATK Best Practice Workflow for 'Data pre-processing for variant discovery' (https://gatk.broadinstitute.org/hc/en-us/articles/360035535912). This has all been run on ...
0
votes
1answer
38 views

Extracting Sequence Unique to a Certain Genome

I have two genomes with high similarity. But I found out that one genome has a longer sequence of about 200 kbp. I try to align the sequence with Mauve. How can I extract this unique 200 kbp?
1
vote
1answer
27 views

replacing periods with hyphen

I am a software engineer and not a bioinformatician. I am looking at some code where they are looking at aligned proteins that are in the A2M alignment format (https://compbio.soe.ucsc.edu/a2m-desc....
1
vote
4answers
64 views

Remove gaps from alignment?

I have an MSA (protein sequence) and I have used various programmes (Clustal, Aliview, MEGA11 etc) to align. However, in all programmes I get many gaps which is not ideal as I am trying to construct a ...
0
votes
2answers
114 views

How to compare sequences of genes obtained after whole-genome sequencing to reference genome?

My idea is to align whole-genome sequencing data (as fastq files after, 30× coverage, gDNA) to the reference mouse genome (NCBI), extract the immunoglobulin locus and compare it to the reference. I ...
0
votes
0answers
13 views

Global vs Local alignment scoring matrix

When creating scoring matrices for global and local alignments is there are difference regarding the "highest score of the matrix". For example, for the two matrices below, the correct ...
0
votes
0answers
49 views

pysam "Exec format" error

I am a beginner and trying to read a bam file in Python. The lines below throw the error ...
1
vote
0answers
35 views

Bowtie2 gets stuck on alignment

I am aligning a fastq file as follows: ...
1
vote
0answers
20 views

Colouring amino acid substitutions by scoring matrix

I have a list of site-specific amino acid substitutions from a mutagenesis experiment which I am visualising by colouring the structure of the protein in PyMOL. I would like a way to colour the ...
0
votes
0answers
18 views

Type and number of gaps in sequence alignments

I used Kalign and Muscle to align given sequences, the results are presented below. My question is, based on the two alignments which tool seems better? I would personally believe that the Muscle tool ...
2
votes
1answer
28 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
1
vote
1answer
21 views

Given two ADN sequence, can there be multiple optimal alignement? And how to optimally find them?

Given two sequences, I know we can determine optimal alignment of sequence with the Needleman–Wunsch algorithm. But is it possible that two alignments have multiple optimal alignment (I guess it would ...
2
votes
1answer
26 views

mpiblast alternatives?

I am looking for a sequence alignment software capable of pairwise alignment of a large number of protein sequences (10^7). I tried to go for mpiblast: https://wiki.canterbury.ac.nz/display/UCHPC/...
0
votes
0answers
37 views

Does the alignment need to be redone when using SAW method to test long branch attraction?

I am looking into different methods to test the long-branch attraction problem. In this chapter they talk about the SAW method - excluding one and the other taxa from the dataset and see if they ...
2
votes
0answers
28 views

How to get phylogenetic tree from multiple genes?

I constructed a phylogenetic tree using a gene (example - secA). I had to gather the same gene sequence for all the required species from public database-NCBI and then constructed the tree after ...
0
votes
0answers
46 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
-3
votes
1answer
35 views

Where to find rat genome for STAR alignment?

I'm trying to find the rat genome to carry out STAR alignment for several FASTQ files. Where would I find these files?
-1
votes
1answer
44 views

Alignment statistics

Given a multi-fasta multiple sequence alignment file, is there a quick way/tool to calculate average pairwise sequence identity? Even better, given a whole genome alignment file (...
1
vote
0answers
59 views

How to modify dot plot in MUMmer 3 for bacteria comparative genomics?

I was trying to make a dotplot to visualize genome-genome sequence alignment by using the MUMmer 3 software (it is typically used to compare whole genome sequences of bacteria). I runned the same ...
2
votes
2answers
72 views

What is the file .mums created by mummer?

I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I did are: 1.create a file .mums with the following command line: ...
4
votes
1answer
49 views

How do you convert Raw Alignment Score to Bit Score?

I'm coding a pipeline where I make a lot of pairwise alignments, and I end up with raw alignment scores. But, I really need to look at my results in terms of bit scores. I know that the formula is: $𝑆...
0
votes
1answer
52 views

Smith-Waterman traceback with large gaps

I am currently trying to understand how the traceback algorithm is supposed to work for the smith-waterman algorithm as my current understanding breaks down in case of a large alignment gap. Assume ...
2
votes
1answer
28 views

Python package or CLI tool outputting mutations of sequence with respect to reference

I'm new to bioinformatics, and I'm looking for a tool that takes two FASTA files, one containing a reference, let's call it A.fasta, the other another sequence, let'...
1
vote
1answer
55 views

fastq file format unknown

I have paired-end fastq files some of which seem to be in a weird format (from a collaborator, not a public database). When I cat the file I get what seem to me to ...
2
votes
1answer
60 views

Get Salmon mapping/alignment summary

With HISAT2, after the alignment of fastq files you get an alignment summary like this: ...
1
vote
1answer
31 views

Differentiating molecules based on peptide sequence? How to annotate?

I want to differentiate between classical class I and non classical class I MHC molecules in a model organism using well conserved structural features within classical MHC I molecules (eg intradomain ...
1
vote
1answer
24 views

Alignment to verify plasmid from forward and reverse Sanger sequencing reads

I am analyzing Sanger sequencing data to verify whether or not the correct protein coding sequence was inserted during cloning. For each sample, I have both forward and reverse Sanger sequencing reads ...
1
vote
0answers
51 views

Alignment tools on desktop for peptide alignment sequence and how to make annotations on alignments look presentable?

I have 10 transcripts where I need to do 5 peptide sequence alignments (2 transcripts per alignment). I need to do this in order to indicate which amino acids lead to which domains. My questions are ...
3
votes
1answer
36 views

Finding 2000 bp sequences that occur more than once in the genome

I am looking for a software that can identify long sequences (1500-2000 bp) that occur more than once in my genome of interest. A k-mer counter like KMC could have worked, but KMC has a max limit of ...
1
vote
1answer
80 views

What is the meaning of split read?

I want to use rna seq data to later perform functional tests on fusion genes. so before that I need to filter the "best results" (of rnaseq) for deciding which candidates I actually want to ...
3
votes
2answers
118 views

Sequence allignment with suffix array?

I'm writing the code from scratch and not using libraries for the actual indexing/search since it's a project for school. Any blackbox advice is fairly useless. I'm planning on aligning some short ...
1
vote
1answer
43 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
2
votes
1answer
32 views

Understanding ViennaRNA RNAdistance scoring table

I'm trying to compare the output of 2 different algorithms of RNA structure prediction (my implementation of Nussinov vs RNA-mfold algorithm) using the RNAdistance algorithm that is part of ViennaRNA ...
1
vote
0answers
32 views

Combine two alleles to genotype locus?

I have a following fasta (produced by stacks populations): ...
2
votes
1answer
91 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
2
votes
2answers
133 views

Calculate genome coverage and depth from alignment

I have a .bam alignment file and a genome reference .fasta file. I am looking for a easy to use tool (that I can reference in a publication) to calculate the percentage coverage of the reference by ...
0
votes
1answer
28 views

How can I get bedtools to tell me which genes are being expressed?

I'm trying to align the Acinetobacter baumanii genome to a genome. I've already done the alignment, and I want to use bedtools to see which genes are being expressed exactly. When I try running the ...
1
vote
1answer
54 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
0
votes
0answers
21 views

going from probe sequence to hgnc gene symbol

I have a bunch of (human) Agilent probes (both probe ID and the actual sequence, some custom array), and I would like to get the hgnc gene symbol based on the actual probe sequences, rather than the ...
1
vote
1answer
54 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
2
votes
1answer
86 views

Global alignment between two sequence X and Y with maximum number of identical matches

If 2 protein sequence X of length m and Y of length n and if there are several highest scoring global alignments, then I want to get one alignment that has largest number of columns in which a letter ...
0
votes
0answers
47 views

How to read E-value annotation on NCBI BLAST?

i am a bit confused how to read the current E value annotation on NCBI BLAST results. I looked into the matter but could not find an factual answer . What i understood so far: E -values are the ...
0
votes
0answers
23 views

Trouble aligning next generation sequencing data to reference genomes using QuasR package in Bioconductor. Cannot import .txt

I'm trying to check the quality of my paired end read sequencing data. I am following this pipeline (https://f1000research.com/articles/4-1062#ref-21) which uses QuasR in the first step. My list of ...
-3
votes
1answer
42 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
4
votes
1answer
118 views

Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the ...

1
2 3 4 5