Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
166 votes
4 answers
91k views

Why does the SARS-Cov2 coronavirus genome end in aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa (33 a's)?

The SARS-Cov2 coronavirus's genome was released, and is now available on Genbank. Looking at it... ...
user avatar
13 votes
2 answers
10k views

Meaning of BWA-MEM MAPQ scores

Does anyone know what the MAPQ values produced by BWA-MEM mean? I'm looking for something similar to what Keith Bradnam ...
user avatar
  • 233
13 votes
1 answer
5k views

Better aligner than bowtie2?

Bowtie2 is probably the most widely used aligner because of it's speed. Burrow-wheeler (BW) algorithms (including bwa) tend to ...
user avatar
11 votes
1 answer
2k views

Why does a very strong BLAST hit get lost when I change num_alignments, num_descriptions or max_target_seqs parameter?

Disclaimer: This is a self answered question for documentation purpose and I adapted this from the following github gist. Especially from users terrycojones and peterjc as well as sujaikumar who ...
user avatar
  • 381
10 votes
3 answers
3k views

Which sequence alignment tools support codon alignment?

Sometimes it useful to perform a nucleotide protein coding gene sequence alignment based on codons, not on individual nucleotides. For example for further codon model analysis it is important to have ...
user avatar
9 votes
3 answers
2k views

A new paper suggests the Corona Virus has "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1" - What does this mean?

Quote: We found 4 insertions in the spike glycoprotein (S) which are unique to the 2019-nCoV and are not present in other coronaviruses. Importantly, amino acid residues in all the 4 inserts have ...
user avatar
9 votes
2 answers
1k views

Is there a standard definition for "assembly polishing"?

Is there a standard definition for "assembly polishing" in the field? Is there a standard definition for what polishing algorithms do? My understanding of "polishing" is strongly influenced by ...
user avatar
  • 1,363
8 votes
2 answers
2k views

What is 'k' in sequencing?

When a DNA sequence is sequenced, I've only ever dealt with A,T,C,G and N which indicates un-identifiable bases. However, I came across a 'k' recently and I had asked another researcher who gave me an ...
user avatar
  • 331
8 votes
2 answers
189 views

Understanding some of the computational bottlenecks of Covid-19 research

I am a researcher in high-performance computing (with very little bioinformatics background), and I am trying to understand what are the current biggest computational bottlenecks of software used for ...
user avatar
  • 181
8 votes
1 answer
3k views

What are "split reads" and "intron clusters?"

I'm working through the example data set for LeafCutter and the documentation mentions "split reads": This will cluster together the introns fond [sic] in the junc files listed in test_juncfiles....
user avatar
7 votes
4 answers
2k views

What is a simple command line tool for doing Needleman-Wunsch pair-wise alignment on the command line

I have two DNA strings: GGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGC and AGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGG I want a tool that allows me to do something like this on the ...
user avatar
  • 2,051
7 votes
2 answers
2k views

Definition of "seed" in sequence alignment

I would like to know what is meant by "seed" for various sequence aligners. How is it important?
user avatar
7 votes
2 answers
475 views

How to check if indels in VCF files are left or right aligned?

I downloaded a VCF file from dbSNP, and I'm curious if the indels in the file are left-aligned for GRCH37 genome. The documentation doesn't say anything. How can we tell if a VCF file has left or ...
user avatar
  • 2,649
7 votes
1 answer
3k views

BLAST(n): No hits found

I am currently exploring the BLAST program, just for testing purpose i generated two FASTA files, containing two genes A and B, such that B is just a motif of repeated 'G's that occurs in A. file A....
user avatar
  • 277
7 votes
2 answers
1k views

Waterman-Smith-Beyer Sequence Alignment

I am having trouble understanding the affine gap penalty in the following example - I am not sure where the 3 and 4 come from or the 4 and 5 in cells 1,3 and 2,4. I'm not understanding how the affine ...
user avatar
  • 173
7 votes
1 answer
255 views

Sequence alignment using BWT

My Problem: Skipping some specific background, what I want to do is judging whether some soft-clipping sequences are the same, which may result by the same SV event. Colored bases in Fig.1 is an ...
user avatar
6 votes
2 answers
711 views

Are phylogenetic tree construction algorithms any different than general clustering algorithms?

Are phylogenetic tree construction algorithms any different from clustering algorhithms? I suspect the answer is no. Of course phylogenetic tree construction uses biological knowledge, e.g special ...
user avatar
6 votes
3 answers
612 views

Generating the reconstructed alignment from BAM

I have a (small) BAM file with CIGAR and MD fields. Question 1: What tools exists in Python and/or R to reconstruct the alignment between the reference and the read in a BAM? Given that this is a ...
user avatar
6 votes
1 answer
106 views

Does the DNA or RNA of some ethnic groups map better than others' to the human reference genome sequence?

I believe that the human genome reference took DNA samples from different people and that some natural variation is included in extra contigs. However, the human reference genome comes from a ...
user avatar
6 votes
1 answer
77 views

Why aren't clustal alignments stable under deletion of some of the sequences?

I'm new to pairwise and multiple sequence alignment in general, but I thought I understood how clustal works -- k-tuple distance is a cheap metric that's 'probably approximately' monotonic in the real ...
user avatar
  • 163
6 votes
1 answer
99 views

Is there a way to assemble contigs starting from a specific sequence?

My work involves searching for marker genes/fragments in metagenomic databases (like the Sequence Read Archive). Once I find these sequences, I would like to know more about the neighboring genomic ...
user avatar
  • 595
6 votes
1 answer
520 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
user avatar
  • 61
6 votes
1 answer
100 views

What does it mean if aligned genomes are not of the same length?

I am aligning 4 genomes of Psuedomonas chlororaphis using progressive mauve software. Command used: ...
user avatar
5 votes
4 answers
4k views

How to create Phylogenetic Trees from fasta files in Python or R?

I have around a hundred Fasta files (and will collect several thousand) with DNA sequences and +50x coverage. What is a recommended method to construct a phylogenetic tree? Solutions in Python or R ...
user avatar
  • 1,181
5 votes
6 answers
1k views

Identifying Indels from Chromatograms

I have around 100 chromatograms (.ab1 files) from Sanger sequencing a genome at loci believed to have an indel. I'm new to interpreting this kind of data in ...
user avatar
  • 183
5 votes
3 answers
3k views

How to get fasta alignment file from SAM/BAM file?

I am not talking about consensus sequence, I know how to get consensus sequence using mpileup in samtools/bcftools. As I understand , SAM/BAM files are basically sequence alignment format so it's ...
user avatar
5 votes
1 answer
774 views

Why do I get so many insertions from Minimap2 on my Nanopore WGS?

I'm a starting my analysis on nanopore whole genome sequencing. I start my analysis from this popular Github. The sample I downloaded was WGS for NA12878, so I would assume it's alignment to GRCh38 ...
user avatar
  • 2,649
5 votes
1 answer
1k views

Understanding the initialization of the Needleman-Wunsch algorithm

I would like to ask why when we initialize 0 as the starting point, there are 3 gray boxes that are not used as shown (highlighted in the red box) in the pic? Are these boxes to show that they are ...
user avatar
5 votes
2 answers
656 views

full visualisation of draft genomes alignment

I have two draft genomes (aprox. 500Mb each), one with ~10'000 scaffolds (genome1.fasta) and one with ~1'000 contigs (...
user avatar
  • 2,644
5 votes
1 answer
1k views

What is local realignment and what is the problem it solves?

I am trying to understand local realignment but I could not get a clear idea of what is the problem solved by it. For example, reading Homer and Nelson (2010): Because alignment algorithms map ...
user avatar
  • 1,723
5 votes
2 answers
220 views

Calculate the percentage of each unique phylogenetic tree in a BEAST output

I have a nexus formatted BEAST output containing 20,000 phylogenetic trees of seven taxa. Is there any way to get the percentage of each unique phylogenetic tree contained in this output? I already ...
user avatar
  • 191
5 votes
1 answer
852 views

Ancestry of the coronavirus 2019-nCov, WuHan city, China

In one of the answers to another question about the corona virus a link was given to this phylogenetic analysis of the virus. Can somebody assist a non-bio type here? It seems to show that the ...
user avatar
5 votes
1 answer
521 views

How to output all sequences with bwa mem, not `*`?

I've been running bwa mem -a for alignment, using the -a flag---this will output all alignments for SE or unpaired PE I've ...
user avatar
  • 1,363
5 votes
3 answers
750 views

How can I only get the species name for fasta sequences from blast results?

I am trying to make a phylogenetic tree from sequences obtained with blast. I have files that contains hundreds of fasta protein sequences which are all named like ...
user avatar
  • 51
5 votes
1 answer
720 views

Does the ".full.aln" file produced by snippy-core contain all bases of my input sequences aligned to the reference genome?

I have a number of sequences and a reference genome. I used snippy to align each individual sequence with the reference genome. I then used ...
user avatar
  • 51
5 votes
1 answer
82 views

Are there certain alignment methods/tools which perform better with a high density of indels?

I have a set of experiments which should result in WGS reads with a high density of indels. Question: Are there certain alignment tools/methods which perform respectively "better" with these reads? ...
user avatar
  • 1,363
5 votes
1 answer
588 views

Multiple sequence alignment with R [closed]

I want to incorporate Multiple sequence alignment into our Shiny app, i.e. allow the possibility of selecting different nucleotide sequences, and do a multiple sequence alignment in real-time. The ...
user avatar
5 votes
1 answer
160 views

Evaluate clusters of individuals by using their sequence data

For a dataset of several hundred individuals, I applied a hierarchical clustering to generate clusters based on a functional trait that sets them apart. My task is now to evaluate if these clusters ...
user avatar
  • 51
5 votes
0 answers
41 views

Where to find asymmetric nucleotide substitution matrix with IUPAC encodings?

I am using the pairwiseAlignment function from the Biostrings package to calculate the distance between a consensus sequence and ...
user avatar
  • 443
4 votes
1 answer
280 views

Can blat use more than one core/CPU to speed up the alignment?

I am using BLAT to align two versions of the genome of C. elegans. I can see in the Activity Monitor of my Mac Book Pro High Sierra that blat is using 100% of a CPU....
user avatar
4 votes
5 answers
2k views

Fast and reliable alternatives to blast

After some unexpected results (and previously reported) I heard that there are other tools for finding similar sequences besides blast that are faster and more accurate. I only found hmmer, but I don'...
user avatar
  • 4,602
4 votes
2 answers
1k views

How to align genomic sequence with corresponding amino acid sequence

Does anyone know of a program that can align a genomic sequence with introns with the corresponding amino acid sequence? I have both the genomic sequence and the correct amino acid sequence but no ...
user avatar
4 votes
1 answer
464 views

Interpretion of my coronavirus 2019-nCov, Wuhan, China BLAST tree?

This is the BLAST tree of the latest coronavirus out of China (from Wuhan Institute of Virology, China). It seems strange that there is so much divergence from all the other coronaviruses. Is this ...
user avatar
  • 41
4 votes
2 answers
103 views

How does Li and Durbin's BWA paper compare alignment programs on real data?

Li and Durbin's "Fast and accurate short read alignment with burrows-whleeler transform" found here, says: We evaluate the performance of BWA on ... real paired-end data by checking the fraction ...
user avatar
  • 87
4 votes
1 answer
30 views

Passing custom distance matrix to T_Coffee

I am passing a custom distance matrix to T_Coffee (written in C), as per the docs, but can't seem to get it to work. The documentation says to pass a matrix like this using BLAST format https://...
user avatar
  • 221
4 votes
1 answer
40 views

Identity plus Similarity Interpretation

I am helping a colleague to interpret protein multiple sequence alignment results. My colleague used a third-party proprietary solution (I know...) to calculate the alignment, and one of the resulting ...
user avatar
4 votes
1 answer
76 views

Programmatic way of accessing the FASTA sequence similarity tool (or similar) in Python

I am looking for a tool that performs a sequence similarity algorithm for proteins. More specifically, I am looking for something that would be usable in Python (or anything else usable in the command ...
user avatar
  • 385
4 votes
1 answer
73 views

How do you convert Raw Alignment Score to Bit Score?

I'm coding a pipeline where I make a lot of pairwise alignments, and I end up with raw alignment scores. But, I really need to look at my results in terms of bit scores. I know that the formula is: $𝑆...
user avatar
4 votes
1 answer
169 views

Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the ...
user avatar
  • 69
4 votes
1 answer
88 views

Is there a modern alignment tool tailored for transmembrane regions?

I am looking for a project or tool that allows programmatic pairwise alignments of proteins but that takes care with transmembrane regions of proteins. TM regions are traditionally too information ...
user avatar
  • 399

1
2 3 4 5 6