Questions tagged [sequence-alignment]

Use this tag to refer to the alignment of nucleotide or peptide sequences, producing an arrangement that maximizes similarity between sequences.

Filter by
Sorted by
Tagged with
3
votes
2answers
4k views

Hardware Requirements (specs) for Bioinformatics-dedicated desktop [closed]

I know this is a somewhat general or vague question, but I’m interested in your opinions. I must build a desktop for general bioinformatics activities with human genomes. I will work with Python and R ...
3
votes
1answer
206 views

Seeking explanation of the hg38 files downloaded from bowtie 2 website

I downloaded the H. sapiens, NCBI GRCh38 files from Bowtie's website. After unzipping, there are 6 files, 4 that end in set 1.ebwt, set2.ebwt, set3.ebwt, and set4.ebwt and two that end in set.rev.1....
3
votes
1answer
96 views

Restricting match output for multiple sequence alignment using mafft?

So I aligned roughly 5k sequences and I got my output using mafft. However, I want to restrict the output to only present conserved segments of a specific length (let's say 25bp). Does mafft have ...
7
votes
2answers
391 views

How to check if indels in VCF files are left or right aligned?

I downloaded a VCF file from dbSNP, and I'm curious if the indels in the file are left-aligned for GRCH37 genome. The documentation doesn't say anything. How can we tell if a VCF file has left or ...
4
votes
1answer
258 views

Can blat use more than one core/CPU to speed up the alignment?

I am using BLAT to align two versions of the genome of C. elegans. I can see in the Activity Monitor of my Mac Book Pro High Sierra that blat is using 100% of a CPU....
6
votes
1answer
430 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
5
votes
6answers
1k views

Identifying Indels from Chromatograms

I have around 100 chromatograms (.ab1 files) from Sanger sequencing a genome at loci believed to have an indel. I'm new to interpreting this kind of data in ...
2
votes
3answers
3k views

How BLOSUM Matrix is constructed and calculated

I would like to ask how BLOSUM matrix is constructed and calculated ? I read the wikipedia and I still do not understand it. I do not understand the mathematical calculations as I have low knowledge ...
5
votes
1answer
838 views

Understanding the initialization of the Needleman-Wunsch algorithm

I would like to ask why when we initialize 0 as the starting point, there are 3 gray boxes that are not used as shown (highlighted in the red box) in the pic? Are these boxes to show that they are ...
5
votes
1answer
457 views

How to output all sequences with bwa mem, not `*`?

I've been running bwa mem -a for alignment, using the -a flag---this will output all alignments for SE or unpaired PE I've ...
7
votes
4answers
2k views

What is a simple command line tool for doing Needleman-Wunsch pair-wise alignment on the command line

I have two DNA strings: GGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGC and AGAAGGAGGGAGGGAAGAGGAGGGAGAAGGAGGGAGGGAAGAGGAGG I want a tool that allows me to do something like this on the ...
4
votes
5answers
2k views

Fast and reliable alternatives to blast

After some unexpected results (and previously reported) I heard that there are other tools for finding similar sequences besides blast that are faster and more accurate. I only found hmmer, but I don'...
5
votes
1answer
571 views

Does the ".full.aln" file produced by snippy-core contain all bases of my input sequences aligned to the reference genome?

I have a number of sequences and a reference genome. I used snippy to align each individual sequence with the reference genome. I then used ...
5
votes
2answers
555 views

full visualisation of draft genomes alignment

I have two draft genomes (aprox. 500Mb each), one with ~10'000 scaffolds (genome1.fasta) and one with ~1'000 contigs (...
0
votes
1answer
246 views

Exporting nt's differences from MEGA alignment

I have an alignment of some full genome sequences of DENV1 that we have recently sequenced from the serum of patients. I have already cleaned the sequences, built the alignments and done the SNPs ...
6
votes
1answer
199 views

Sequence alignment using BWT

My Problem: Skipping some specific background, what I want to do is judging whether some soft-clipping sequences are the same, which may result by the same SV event. Colored bases in Fig.1 is an ...
1
vote
0answers
359 views

How to create a dendrogram of clusters and reconstruct phylogenetic relationship

I'm working with a Daphnia data set looking at the 16s gene pulled from the BOLD database. So far I did a multiple sequence alignment and attempted to cluster and plot a dendrogram: ...
9
votes
1answer
3k views

What are "split reads" and "intron clusters?"

I'm working through the example data set for LeafCutter and the documentation mentions "split reads": This will cluster together the introns fond [sic] in the junc files listed in test_juncfiles....
3
votes
0answers
124 views

How to assign the best gap penalty and gap extension penalty using BLOSUM65 [closed]

For an assignment I must do a pairwise optimal local alignment using BLOSUM65 and five protein sequences. The algorithm I want to use is the Smith-Waterman. Context protein sequencing using Blastp: ...
3
votes
1answer
198 views

Aligning sequence and comparing it against primer

I am looking to show how a primer is consistent among some genomic data. I have a primer of about 23bp and looking to compare it to about 5000 genomic sequences of 10kb. I am unsure how to format it ...
0
votes
1answer
155 views

Find a map/correspondence between two versions of a genome

I am working with two versions of the C. elegans genome. I am finding interesting regions (specifically, tRNA genes) in version 1 and then I would like to know if version 2 also has a tRNA gene in ...
1
vote
0answers
464 views

How to make year scale bar unit in figtree software?

I have generated phylogenetic trees for virus sequences by using beast software. I observed in various research articles that the phylogentic trees also have a scale-bar (which mostly represents ...
2
votes
0answers
31 views

Alignment using secondary and tertiary features of DNA

I m trying to align different sequences of length not greater than 50 bp. Could I incorporate additional information such as stacking energy, entropy, bonds etc as additional criteria in the alignment?...
4
votes
1answer
172 views

Merging ssu-align alignments

ssu-align is an HMM-based MSA tool for ribosome's small subunit (SSU) sequences. It's bundled with three SSU models: archaeal, bacterial eukaryotic Approach Given a set of archaeal and ...
12
votes
1answer
4k views

Better aligner than bowtie2?

Bowtie2 is probably the most widely used aligner because of it's speed. Burrow-wheeler (BW) algorithms (including bwa) tend to ...
2
votes
1answer
207 views

Interpreting bayesian phylogenetic model using Tracer?

I am doing phylodynamic analysis of virus sequences using bayesian method using BEAUti and BEAST. As a part of my analysis I am using Tracer to check how my model is working. I can interpret some of ...
6
votes
1answer
76 views

Why aren't clustal alignments stable under deletion of some of the sequences?

I'm new to pairwise and multiple sequence alignment in general, but I thought I understood how clustal works -- k-tuple distance is a cheap metric that's 'probably approximately' monotonic in the real ...
8
votes
2answers
1k views

Is there a standard definition for "assembly polishing"?

Is there a standard definition for "assembly polishing" in the field? Is there a standard definition for what polishing algorithms do? My understanding of "polishing" is strongly influenced by ...
7
votes
1answer
2k views

BLAST(n): No hits found

I am currently exploring the BLAST program, just for testing purpose i generated two FASTA files, containing two genes A and B, such that B is just a motif of repeated 'G's that occurs in A. file A....
1
vote
0answers
85 views

Mugsy error: Can't find species II dna at output/software/mugsy_x86-64-v1r2.3/mugsy line 501

I have installed mugsy in order to create a multiple genome alignment and a phylogenetic tree of several species of nematodes. The following command successfully pulls out the help: ...
5
votes
1answer
82 views

Are there certain alignment methods/tools which perform better with a high density of indels?

I have a set of experiments which should result in WGS reads with a high density of indels. Question: Are there certain alignment tools/methods which perform respectively "better" with these reads? ...
1
vote
0answers
155 views

igv_plotter error: Xvfb did not start

I am trying to get screenshots from alignments of reads to a genome in IGV (Integrated Genome Viewer) using igv_plotter. ...
-1
votes
1answer
522 views

Command not found error on HISAT2

I have been attempting to map reads to a reference genome using HISAT2 using the Pertea, et al 2016 Nature Protocols paper. I am able to successfully generate an index (using the hisat2-build command),...
5
votes
1answer
157 views

Evaluate clusters of individuals by using their sequence data

For a dataset of several hundred individuals, I applied a hierarchical clustering to generate clusters based on a functional trait that sets them apart. My task is now to evaluate if these clusters ...
1
vote
1answer
123 views

Creating frequency plot from weblogo with frequency unit on the Y axis

Hello I am trying to create frequency plot for a motif with frequency unit on the Y axis from 0 -100 nt as the unit as represented in this paper.(Seiler et al., 2018)
6
votes
1answer
104 views

Does the DNA or RNA of some ethnic groups map better than others' to the human reference genome sequence?

I believe that the human genome reference took DNA samples from different people and that some natural variation is included in extra contigs. However, the human reference genome comes from a ...
6
votes
3answers
507 views

Generating the reconstructed alignment from BAM

I have a (small) BAM file with CIGAR and MD fields. Question 1: What tools exists in Python and/or R to reconstruct the alignment between the reference and the read in a BAM? Given that this is a ...
2
votes
1answer
394 views

Can I export the SNPs between whole genome alignments using the command line?

I am using Mauve to align two whole genomes. I use the following command to get the alignment in xmfa format: ...
0
votes
1answer
345 views

Why is my STAR reference genome indexing aborting on my GNU/Linux server but not on my Mac OS X laptop?

I am running the following command to index my genome: ...
2
votes
1answer
3k views

Can I index a compressed FASTA file using STAR?

I am using STAR to align RNA-seq reads to a reference genome. Before the alignment, I need to generate an index of the reference genome. I use the following code to generate the index successfully: <...
3
votes
2answers
311 views

How to read .bwt file .sa file?

In BWA project in bwt.c file I found bwt_dump_bwt method and bwt_dump_sa method. I want to use them to read .bwt file and .sa file. I wrote the following program: ...
1
vote
2answers
439 views

How BWA generate index files?

I need to know how BWA generate bw and sa in less memory usage ? Do they save all rotations temporary ? I need to know do BWA stores all rotations so that it can sort the rotations alphabetically ? ...
2
votes
1answer
232 views

Generating burrows-wheeler-transform and a suffix array of a DNA sequence with less memory

Also posted on biostars After indexing bwa index -a bwtsw reference.fa I got files. like .bwt file and .sa file. The naive way of generating these file is:   ...
4
votes
2answers
96 views

How does Li and Durbin's BWA paper compare alignment programs on real data?

Li and Durbin's "Fast and accurate short read alignment with burrows-whleeler transform" found here, says: We evaluate the performance of BWA on ... real paired-end data by checking the fraction ...
1
vote
1answer
28 views

Why does RATT create a directory with chromosome sequences and how can I stop it?

I have run RATT to transfer the annotation from a reference strain to another strain. For this, I have run: ...
2
votes
1answer
193 views

How to generate a weblogo image that takes into account sequence frequencies?

I have a large aligned amino acid sequences file (fasta file) from next generation sequencing data. The unique sequences have been aligned but these all have certain read counts (frequencies ...
3
votes
2answers
169 views

How to find/build the evolutionary history of a protein from its sequence?

I'd like to build the evolutionary history of a protein, given its sequence. Namely, given a FASTA entry how can I build an evolutionary tree? Here is the 5wxy protein as an example: ...
1
vote
2answers
44 views

Mapping bisulfite reads to a reduced size genome

Is it worth mapping bisulfite reads (WGBS) to a reduced size genome? I'm interested only in modifications in CpG context, thus instead of mapping to a whole genome (human genome) I would: Extract ...
3
votes
2answers
98 views

Is there a tool that can take a protein's amino acid sequence and would display it's locus on the genome?

I have the UNIPROT IDs, PDB IDs and FASTA files of several known proteins. I am looking for a tool that can take as input the protein's amino acid sequence and display the coding nucleotides of those ...
1
vote
0answers
133 views

Can Mauve export indels or is there an whole-genome aligner that can export indels?

I have aligned two whole genomes of the same species in Mauve using progressiveMauve. One of the genomes is 2 megabases longer than the other so I know it must contain some insertions. Looking at the ...