Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

Filter by
Sorted by
Tagged with
1
vote
0answers
25 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
-1
votes
1answer
102 views

How to get a FASTA format file with the DNA sequences of all annotated genes?

I am analysing Pyrococcus Furiosus DNA sequencing data by considering data published here in NCBI. When I click on "Send to">"Gene Features">"FASTA format" I ...
0
votes
1answer
32 views

How to Read SCF file in Python?

Is there any way that I can read SCF file in python like in R using sangerseqR, I have tried with Biopython, it seems it does not support this format.
0
votes
0answers
43 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
1
vote
1answer
44 views

Where to find publicly available Sanger chromatography data?

I am looking for any public available databases where I can download Sanger chromatography data ideally in Ab1 or SCF file format. I need extremely large amounts of this, since I want to use it for ...
0
votes
1answer
25 views

calculating kmer nucleotide frequency per column

I have a list of sequences: CAGGTAGCC CCGGTCAGA AGGGTTTGA TTGGTGAGG CAAGTATGA ACTGTATGC CTGGTAACC Each sequence is nine nucleotides long. I want to calculate ...
0
votes
1answer
29 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
0
votes
1answer
105 views

Converting Fastq files to Fasta files on Ubuntu

I am new to bioinformatics and programming. I tried to convert my fastq files to fasta file, but got this. What could be wrong? ...
2
votes
1answer
23 views

Retrieval of metadata of a batch of 3953 sequence data from GISAID database

Can we retrieve metadata (such as date of collection of sequence data, location, etc.) for a batch of 3953 GISAID accessions from the GISAID database? I am not very comfortable with GISAID. I am more ...
2
votes
1answer
40 views

How to deal with wildcards (N) in sequence logos

This is an open question that came to my mind recently, though it might be that it is not a common use case. The purpose is to find common patterns in a collection of sequences by representing the ...
1
vote
2answers
69 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
0
votes
1answer
41 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
1
vote
2answers
69 views

Get frequency of index sequences of fastq file

I recently did some sequencing on a MiniSeq and unexpectedly the Undetermined_S0_L001_R1_001.fastq.gz file contained quite a lot of data (about 40% of total). I ...
-3
votes
1answer
41 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
0
votes
0answers
6 views

Can I run output from Illumina genome Analyser II, IIx and Illumina Hiseq 2000 with MetaPhlAn and HUMAnN and compare the output?

I have a dataset where some of the samples has been sequenced with Illumina Genome Analyser II, some with ...
0
votes
0answers
11 views

How to annotate ChIP peaks base on NCBI sequence name?

I have chip-seq peaks based on NCBI genome which looks like the following: ...
0
votes
1answer
74 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
1
vote
2answers
41 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
1
vote
1answer
58 views

Interpreting contig alignments to a reference genome

I have applied two de novo genome assembly tools to data from the run SRR12707453, corresponding to a phage (I downloaded the data and have no relation with the authors of the study). Using rnaSPAdes ...
1
vote
2answers
159 views

Are codons in RNA layered? Are we misinterpreting RNA codons?

I am analyzing nucleotide base-pair patterns in RNA and DNA, and had a thought about RNA and DNA (Let me first state though, I am not a biologist; I am an algorithmatician, employing a sort of ...
0
votes
3answers
301 views

Finding motifs: fasta file with 10,000 sequences

I am new to Python. I am trying to parse a fasta file containing 10,000 sequences to look for motifs (microsatellites in particular). I tried using Seq Utils to parse my sequences for a particular ...
1
vote
1answer
25 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
1
vote
1answer
62 views

How to understand methylation level?

For Bisulfite Sequencing data, we can calculate methylation level for a specific locus, $$ \mbox{methylation level} = \frac{\mbox{# methelyated reads}}{\mbox{# total reads}} $$ Here I think, for this ...
1
vote
0answers
56 views

How to implement SEG (Wootton and Federhen ,1993) algorithm?

I want to implement SEG in my MATLAB environment and I'm relying on Wootton and Federhen (1993) Reading the article I cannot succeed to understand what kind of process I have to implement in order to ...
0
votes
2answers
31 views

Separating peaks of chip-seq with specific length

My data contain several chip-seq results. I have the peaks called by MACS2.I wanted to only look at those peaks that their size is e.g 500bp to 1000bp. How can I separate those peaks efficiently? I ...
2
votes
1answer
23 views

How to calculate the number of peaks that are upstream/downstream of some other peaks

I have 3 histone marks,I have used Macs2 for peak calling and diffBind to analyze the peaks. I was wondering if you know any way to calculate the peak numbers of one specific histone mark that occur ...
1
vote
1answer
37 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
4
votes
1answer
3k views

Calculating average coverage for .bam files (sequence data)

(Full discolosure that this is my first time working with sequence data, and with the bash scripting.) I need to calculate the average coverage for any .bam file. After some searching I wrote the ...
1
vote
1answer
79 views

Do you know a program/script to count how many sequences have mismatches on each position of my primers?

I'm working with primer analysis and design, and so far I've performing it in Excel but: a) I don't like Excel, b) I do it manually, c) I don't like Excel, d) it gets tedious when working with ...
0
votes
3answers
80 views

differential analysis of chip-seq data

I have several sets of chip-seq data. I called the peaks using Macs2. I am pretty new to the field and I will appreciate any help. I wanted to annotate the peaks and see which peaks are shared between ...
0
votes
0answers
21 views

Generating taxonomic hierarchy by species/genus name

I am attempting to create a reference library of DNA plant barcodes in the ITS2 barcode region for plants from a specific region (Panama). I downloaded all the sequences for plants that resulted in a ...
1
vote
0answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
1
vote
0answers
50 views

What steps should I follow for DNA analysis, for a classification problem?

I have a bed file which contains DNA sequences information as follow: ** ...
-1
votes
1answer
65 views

Compare nucleotide mutation with amino acid

To begin with I have two nucleotide sequence to compare I want to see how they might have evolved in terms of sequence similarity and differences. One of the way i can think of is align the sequences. ...
1
vote
1answer
66 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
1
vote
0answers
33 views

Available Protein sequence alignment dataset and HMM model

It may better to move the question here. I am new to biology and I find my algorithm may be used in the Protein sequence alignment, since it is a henced HMM model. I find that people use HMM to ...
0
votes
0answers
24 views

Determining a Gene's Unknown Function

I'm a beginner in this field (so pardon my rudimentary knowledge/explanation) trying to understand ways on how I could potentially identify genes of unknown function. I am trying to get as close as I ...
1
vote
1answer
65 views

Evaluating amateur bioinformatics results

I've might have created a new algorithm for finding patterns in DNA. The technique has not been used before, and it managed to find a 33-mer with corresponding complement that exists both in E. Coli ...
0
votes
1answer
56 views

Arlequin files not able to converge beyond 2000 steps for some .arp files

When I use .arp files in arlequin to run mismatch distribution it says that can’t converge beyond 2000 steps and also no graphs are produced.can someone suggests what can I do to overcome this problem
1
vote
2answers
102 views

How to combine two Genome-wide Association Study (GWAS)? [closed]

I did a GWAS analysis in the past for antibiotic resistance of E. Coli and the results were interesting (matching the literature). I did a new GWAS analysis for some new samples, but the results are ...
0
votes
1answer
50 views

Is there a way to get the code from "github.mit.edu"?

everyone. I am a postdoc who just begins to analyze single-cell RNA-seq data. Nowadays, I found a really interesting paper (https://doi.org/10.1016/j.celrep.2018.10.047, PMID: 30404002). So, I ...
0
votes
2answers
111 views

How to make Venn diagram for the Macs peak calling output of two data sets?

I have two outputs of macs2 peak calling for two of my data sets. I wanted to plot the Venn diagram to see how many peaks are shared. I mainly work on Unix/Linux. Do you know any way that I can have ...
1
vote
1answer
29 views

After completing the evaluation, how to predict PTM lysine or any other modification with unlabeled data for making a web server?

I have created a model with SVM classifier and evaluated it with 5-fold cross-validation. The dataset was sequence data containing lysine modified sites. Now I want to build a web server where anyone ...
1
vote
2answers
62 views

Is it possible to go from a digital sequence to an actual nucleotide?

I'm trying to learn about what the state of technology is at presently. It seems like we clearly can go from nucleotide to digitally stored sequence, but can we transcribe something from the digital ...
1
vote
2answers
135 views

how to use list of gene id to get cds sequence(cds fasta file have many annotation, only gene id: is same to query id)

i have a question when i want to extract cds sequence using gene id. but cds file is not just start with >gene is, it has many other annotation. the only same is star with gene: cds fasta: ...
1
vote
1answer
75 views

Significance of k-mer length in COVID-19 sequence analysis?

I'm getting started in biology and bioinformatics with sequencing the SARS-Cov-2 or Coronavirus genome. I'm interested in this code which identifies k-mers in the genome: ...
1
vote
1answer
121 views

plot correlation between several bam files

I have several mab files from medip-seq. they supposed to be replicates and I have to draw their correlation. First I used multiBamSummary from deeptools to merge all the bam files based on bi/bed. ...
1
vote
2answers
2k views

merging two/or more bed file into one bed file

I am trying to merge two bed files (more in future) to one. my bed files are something like : . I need to merge them in a way to have the shared chromosome location. Is there a way to do that ?
8
votes
2answers
183 views

Understanding some of the computational bottlenecks of Covid-19 research

I am a researcher in high-performance computing (with very little bioinformatics background), and I am trying to understand what are the current biggest computational bottlenecks of software used for ...
3
votes
1answer
67 views

Overlap in Paired-end Reads for Sequencing?

Regarding Sequencing: Do/can the paired-end reads have overlaps?