Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

Filter by
Sorted by
Tagged with
0 votes
0 answers
10 views

Comparing loci across catalogs

Context: I'm using the Stacks (v2.59) ref_map.pl command to analyze garden and wild samples of a plant species, and have aligned my paired-end RAD reads to a reference genome (using GSNAP). The goal ...
user avatar
2 votes
1 answer
73 views

What is the different between the I-TASSER, phyre2, SWISS-model in the 3D tertiary structure?

What is the difference between the I-TASSER, phyre2, and SWISS-model in the 3D tertiary structure? How do they get the results? When I did a prediction, I got a similar result for the highest template ...
user avatar
0 votes
0 answers
28 views

Locate the saved template of minknow

I am using minknow on ubuntu. After saving the template (settings), where is that file locally stored in the system? Also what is its format/extension?
user avatar
2 votes
1 answer
69 views

Samtools sort: most efficient approach to sort a single sample after aligning split .fastq files

Related to my other question (Samtools sort: most efficient memory and thread settings for many samples on a cluster), we need to optimize samtools sort as we ...
user avatar
  • 1,234
2 votes
2 answers
291 views

Samtools sort: most efficient memory and thread settings for many samples on a cluster

We're preparing to analyze thousands of .bam files beginning with re-alignment, sorting, etc. Complicated question: Has anyone investigated the optimal thread and ...
user avatar
  • 1,234
2 votes
1 answer
95 views

How to run MD5 check for multiple fastq files in different subdirectories?

I have received Illumina sequencing reads for 100 samples. I have 8 R1.fastq.gz and 8 R2.fastq.gz files for each sample in each ...
user avatar
1 vote
1 answer
37 views

How to rescale a function?

When we have a function which takes values ​​in [a,b] and which returns values ​​in [c,d], what transformation can we do so that the function takes values ​​in [0,1] and returns values ​​in [0,1] ...
user avatar
1 vote
1 answer
139 views

tensorflow nn_model for DNA sequences: Matrix size-incompatible: In[0]: [2,1], In[1]: [784,300]

Hope anyone can help a beginner here. I'm building a proof-of concept tensorflow classifier for DNA sequences. However, the NN model does not let through train and test vectors saying the matrix size ...
user avatar
  • 11
0 votes
1 answer
41 views

How to improve a genome assembly using Dovetail and PacBio assembly?

I have more of a conceptual question. I have two genome assemblies from the same plant, one from Dovetail technology (~998 Gb) and another is PacBio HiFi assembly (~1.1 Gb). The Dovetail assembly is ...
user avatar
1 vote
2 answers
116 views

Help with MinION sequencing data species identification

Hi I'm new to bioinformatics and have just completed my first run on the MinION (long read sequencing Oxford Nanopore Technologies). I was hoping someone could direct me towards R packages, workflow, ...
user avatar
  • 13
1 vote
1 answer
81 views

Why does randomized motif search work?

I'm looking for intuition for why a randomized motif search works. My current thinking is as follows: We are selecting many random kmers from our DNA sequences. The chosen kmers will bias the profile ...
user avatar
  • 127
1 vote
1 answer
27 views

How should I downsample and normalize R1s and R2s and incorporate this into Lexogen's QSPA tool

I am using Lexogen's Quantitative Sequencing Pool Analysis tool (here: https://github.com/Lexogen-Tools/quantseqpool_analysis) to analyze R1 and R2 files. I have been able to successfully run this ...
user avatar
2 votes
1 answer
40 views

How to map list items which are in groups in the dictionary values and return keys corrosponding it?

...
user avatar
0 votes
0 answers
25 views

How to retrieve full-length sequences from hhblits output

I am using hhblits, part of hh-suite3. I am using it to query databases from the Soeding lab, such as BFD or Uniclust30. After having identified hits, could anyone tell me what they use to retrieve ...
user avatar
  • 1
1 vote
0 answers
33 views

Downloading exon-wise gene sequence using commandline

I want to download exon-wise gene sequence of around 200 genes from NCBI. Is there anyway to do this from terminal? I have the transcript id for each sequence and I am using efetch command to download ...
user avatar
2 votes
0 answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
user avatar
  • 145
-1 votes
1 answer
123 views

How to get a FASTA format file with the DNA sequences of all annotated genes?

I am analysing Pyrococcus Furiosus DNA sequencing data by considering data published here in NCBI. When I click on "Send to">"Gene Features">"FASTA format" I ...
user avatar
0 votes
1 answer
71 views

How to Read SCF file in Python?

Is there any way that I can read SCF file in python like in R using sangerseqR, I have tried with Biopython, it seems it does not support this format.
user avatar
  • 151
0 votes
0 answers
49 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
user avatar
  • 320
1 vote
1 answer
50 views

Where to find publicly available Sanger chromatography data?

I am looking for any public available databases where I can download Sanger chromatography data ideally in Ab1 or SCF file format. I need extremely large amounts of this, since I want to use it for ...
user avatar
  • 151
0 votes
1 answer
68 views

calculating kmer nucleotide frequency per column

I have a list of sequences: CAGGTAGCC CCGGTCAGA AGGGTTTGA TTGGTGAGG CAAGTATGA ACTGTATGC CTGGTAACC Each sequence is nine nucleotides long. I want to calculate ...
user avatar
0 votes
1 answer
52 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
user avatar
0 votes
1 answer
357 views

Converting Fastq files to Fasta files on Ubuntu

I am new to bioinformatics and programming. I tried to convert my fastq files to fasta file, but got this. What could be wrong? ...
user avatar
3 votes
2 answers
37 views

Retrieval of metadata of a batch of 3953 sequence data from GISAID database

I need to retrieve COVID-19 metadata (such as date of collection of sequence data, location, etc.) for a batch of 3953 GISAID accessions from the GISAID database. I am not very comfortable with GISAID....
user avatar
2 votes
1 answer
40 views

How to deal with wildcards (N) in sequence logos

This is an open question that came to my mind recently, though it might be that it is not a common use case. The purpose is to find common patterns in a collection of sequences by representing the ...
user avatar
  • 143
1 vote
2 answers
145 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
user avatar
0 votes
1 answer
55 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
user avatar
  • 1,347
2 votes
2 answers
101 views

Get frequency of index sequences of fastq file

I recently did some sequencing on a MiniSeq and unexpectedly the Undetermined_S0_L001_R1_001.fastq.gz file contained quite a lot of data (about 40% of total). I ...
user avatar
-2 votes
1 answer
47 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
user avatar
0 votes
1 answer
170 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
user avatar
1 vote
2 answers
49 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
user avatar
  • 149
1 vote
1 answer
80 views

Interpreting contig alignments to a reference genome

I have applied two de novo genome assembly tools to data from the run SRR12707453, corresponding to a phage (I downloaded the data and have no relation with the authors of the study). Using rnaSPAdes ...
user avatar
1 vote
2 answers
168 views

Are codons in RNA layered? Are we misinterpreting RNA codons?

I am analyzing nucleotide base-pair patterns in RNA and DNA, and had a thought about RNA and DNA (Let me first state though, I am not a biologist; I am an algorithmatician, employing a sort of ...
user avatar
0 votes
3 answers
463 views

Finding motifs: fasta file with 10,000 sequences

I am new to Python. I am trying to parse a fasta file containing 10,000 sequences to look for motifs (microsatellites in particular). I tried using Seq Utils to parse my sequences for a particular ...
user avatar
  • 31
2 votes
1 answer
32 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
user avatar
1 vote
1 answer
79 views

How to understand methylation level?

For Bisulfite Sequencing data, we can calculate methylation level for a specific locus, $$ \mbox{methylation level} = \frac{\mbox{# methelyated reads}}{\mbox{# total reads}} $$ Here I think, for this ...
user avatar
  • 113
1 vote
0 answers
64 views

How to implement SEG (Wootton and Federhen ,1993) algorithm?

I want to implement SEG in my MATLAB environment and I'm relying on Wootton and Federhen (1993) Reading the article I cannot succeed to understand what kind of process I have to implement in order to ...
user avatar
0 votes
2 answers
37 views

Separating peaks of chip-seq with specific length

My data contain several chip-seq results. I have the peaks called by MACS2.I wanted to only look at those peaks that their size is e.g 500bp to 1000bp. How can I separate those peaks efficiently? I ...
user avatar
  • 95
2 votes
1 answer
26 views

How to calculate the number of peaks that are upstream/downstream of some other peaks

I have 3 histone marks,I have used Macs2 for peak calling and diffBind to analyze the peaks. I was wondering if you know any way to calculate the peak numbers of one specific histone mark that occur ...
user avatar
  • 95
1 vote
1 answer
42 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
user avatar
  • 95
4 votes
1 answer
5k views

Calculating average coverage for .bam files (sequence data)

(Full discolosure that this is my first time working with sequence data, and with the bash scripting.) I need to calculate the average coverage for any .bam file. After some searching I wrote the ...
user avatar
  • 143
1 vote
1 answer
162 views

Do you know a program/script to count how many sequences have mismatches on each position of my primers?

I'm working with primer analysis and design, and so far I've performing it in Excel but: a) I don't like Excel, b) I do it manually, c) I don't like Excel, d) it gets tedious when working with ...
user avatar
  • 11
0 votes
3 answers
129 views

differential analysis of chip-seq data

I have several sets of chip-seq data. I called the peaks using Macs2. I am pretty new to the field and I will appreciate any help. I wanted to annotate the peaks and see which peaks are shared between ...
user avatar
  • 95
0 votes
0 answers
22 views

Generating taxonomic hierarchy by species/genus name

I am attempting to create a reference library of DNA plant barcodes in the ITS2 barcode region for plants from a specific region (Panama). I downloaded all the sequences for plants that resulted in a ...
user avatar
  • 11
1 vote
0 answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
user avatar
1 vote
0 answers
65 views

What steps should I follow for DNA analysis, for a classification problem?

I have a bed file which contains DNA sequences information as follow: ** ...
user avatar
-1 votes
1 answer
73 views

Compare nucleotide mutation with amino acid

To begin with I have two nucleotide sequence to compare I want to see how they might have evolved in terms of sequence similarity and differences. One of the way i can think of is align the sequences. ...
user avatar
  • 1,640
2 votes
0 answers
80 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
user avatar
  • 206
1 vote
0 answers
42 views

Available Protein sequence alignment dataset and HMM model

It may better to move the question here. I am new to biology and I find my algorithm may be used in the Protein sequence alignment, since it is a henced HMM model. I find that people use HMM to ...
user avatar
0 votes
0 answers
40 views

Determining a Gene's Unknown Function

I'm a beginner in this field (so pardon my rudimentary knowledge/explanation) trying to understand ways on how I could potentially identify genes of unknown function. I am trying to get as close as I ...
user avatar