Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

30 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
2 votes
0 answers
31 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
iamakhilverma's user avatar
2 votes
0 answers
107 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
Adamm's user avatar
  • 206
2 votes
1 answer
137 views

working with cutadapt

I'm working with ion torrent data where I apply the program cutadapt. I'm analyzing ITS seq data, as well as Matk. When I'm using cutadapt, I search the information for this genes, and built new ...
Sofia's user avatar
  • 351
1 vote
0 answers
49 views

Recommendations on Motif scoring functions

I am searching for specific transcription factor binding locations on DNA, and ranking them according the their scores. For this, I am in search of a tool or method that can generate motif scores for ...
Zebra Fish's user avatar
1 vote
0 answers
37 views

Finding mutations in glycosylation sites

We are going to look at the likely N- and O- glycosylation sites within MUC16 (Q8WXI7 · MUC16_HUMAN)§ by in house long-read DNA sequencing data (PacBio). Counting the number of tandem repeats is a ...
Zizogolu's user avatar
  • 2,132
1 vote
0 answers
66 views

Can files with different R1 and R2 lengths be trusted?

I received paired end amplicon sequence from a LAB with different lengths for R1 (320) and R2(280). Should I trust this lab to sequence other samples? Also, I had to do a trimming over the R2 at 220(...
abi's user avatar
  • 11
1 vote
0 answers
65 views

Bracken not working

I have some highly contaminated ancient DNA sequences. I have adapter removed and collapsed these and run them through Kraken2. The Kraken reports show multiple levels of taxa with good numbers of ...
Andy Walton's user avatar
1 vote
0 answers
34 views

Could someone help me understand if all sample within this are control group?

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE117872 I'm teaching myself sequence analysis. This is the count data: and then this is, what I believe to be, the coldata: All I want to know is ...
Antonio's user avatar
  • 129
1 vote
0 answers
92 views

Simple template for calculating Shannon diversity index from FASTQ files with R

I have a bunch of files in FASTQ format and need to calculate the Shannon diversity index from all of them. Is there a simple way to do that with R, some kind of step-by-step recipe? My problem is not ...
vonjd's user avatar
  • 111
1 vote
1 answer
690 views

tensorflow nn_model for DNA sequences: Matrix size-incompatible: In[0]: [2,1], In[1]: [784,300]

Hope anyone can help a beginner here. I'm building a proof-of concept tensorflow classifier for DNA sequences. However, the NN model does not let through train and test vectors saying the matrix size ...
monade's user avatar
  • 11
1 vote
0 answers
90 views

Downloading exon-wise gene sequence using commandline

I want to download exon-wise gene sequence of around 200 genes from NCBI. Is there anyway to do this from terminal? I have the transcript id for each sequence and I am using efetch command to download ...
Saumya Gupta 1910110's user avatar
1 vote
0 answers
91 views

How to implement SEG (Wootton and Federhen ,1993) algorithm?

I want to implement SEG in my MATLAB environment and I'm relying on Wootton and Federhen (1993) Reading the article I cannot succeed to understand what kind of process I have to implement in order to ...
Spartan 117's user avatar
1 vote
0 answers
33 views

Generating taxonomic hierarchy by species/genus name

I am attempting to create a reference library of DNA plant barcodes in the ITS2 barcode region for plants from a specific region (Panama). I downloaded all the sequences for plants that resulted in a ...
uvnomad's user avatar
  • 21
1 vote
0 answers
18 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
user345394's user avatar
1 vote
0 answers
65 views

What steps should I follow for DNA analysis, for a classification problem?

I have a bed file which contains DNA sequences information as follow: ** ...
Giannis Lazaridis's user avatar
1 vote
0 answers
104 views

Available Protein sequence alignment dataset and HMM model

It may better to move the question here. I am new to biology and I find my algorithm may be used in the Protein sequence alignment, since it is a henced HMM model. I find that people use HMM to ...
Qinsheng Zhang's user avatar
1 vote
1 answer
162 views

Arlequin files not able to converge beyond 2000 steps for some .arp files

I am looking at 59 mitochondrial CO1 DNA sequences of length 563bp, but it is a haplotype file and it has 9 haplotypes within. When I use .arp files in arlequin to run mismatch distribution it says ...
Upasana Singh's user avatar
1 vote
0 answers
38 views

How to analyze expression of certain group of genes in certain types of cell?

I need to analyze expression of ~ 400 genes with a certain function in the embryonic stem cells. All these genes are combined into one database with RefSeq IDs. What is a recommended workflow to ...
Ina Izumi's user avatar
1 vote
0 answers
39 views

Building cancer gene database

I am trying to build a database of different cancer genes i.e lung cancer, throat cancer etc. Searched through NCBI website by searching for nucleotide sequences, but I am unable to find appropriate ...
Prabhuraj Metipatil's user avatar
1 vote
0 answers
27 views

How to use DCA to deduce the contacts between 2 proteins ensembles?

I would like to use DCA (direct coupling analysis) to analyze the interface between 2 protein ensembles (how the 2 ensembles interacts). Do you have access to a tutorial on this matter? A source code? ...
0x90's user avatar
  • 1,427
1 vote
0 answers
59 views

How to rebuild the workflow for mining in oomynete genomes in UGENE

I want to recreate the UGENE workflow proposed in Convergence of retrotransposons in oomycetes and plants. After being able to understand the data and hmmsearch Here and Here and getting most of the ...
A.Dumas's user avatar
  • 487
0 votes
2 answers
30 views

How to classify TF motifs by family

I have a FIMO output, the input sequences were putative promoter sequences of several species. I want to graph the positions of these motifs along a horizontal graph, but I want to filter the data by ...
JohnDoe23's user avatar
0 votes
0 answers
20 views

What statistical analysis should I perform on DNA variants from unequal number of case (34) and control (11) samples?

I have performed NGS on 34 patient samples and 11 controls. Now I have variants from both groups but there is obvious difference in number of variants. How can I compare variants of both groups ...
Malik Saad's user avatar
0 votes
0 answers
122 views

Locate the saved template of minknow

I am using minknow on ubuntu. After saving the template (settings), where is that file locally stored in the system? Also what is its format/extension?
K.Harini's user avatar
0 votes
0 answers
96 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
gabt's user avatar
  • 330
0 votes
0 answers
48 views

Determining a Gene's Unknown Function

I'm a beginner in this field (so pardon my rudimentary knowledge/explanation) trying to understand ways on how I could potentially identify genes of unknown function. I am trying to get as close as I ...
Andrew Hollins's user avatar
0 votes
1 answer
149 views

How to use extractfeat?

I am working on a script on bash linux to get the CDS (coding sequence) of a gene using extractfeat by EMBOSS. It gives me the error: Warning: No sequences written to output file I am unsure if my ...
KA97's user avatar
  • 1
0 votes
1 answer
73 views

Error while Importing fastq sequences to jMHC software

I am trying to analyze my .fastq files (MiSeq exon reads) with the jMHC software, but output files I have obtained have no results. I think I might be doing something wrong during the first step: "...
CGabrielaN's user avatar
-1 votes
1 answer
54 views

Is there a data analysis software (free) or code that I can use to view normalized CDR3 amino acid length distributions?

Is there a data analysis software (free) or code that I can use to view normalized CDR3 amino acid length distributions? Regarding code, preferably using Python or R. EDIT: Added a picture of the non-...
SData11's user avatar
-2 votes
1 answer
336 views

How to calculate Allele frequency from vcf file

Organism under investigation is Plasmodium falciparum. How to calculate the allele frequency for each row? I tried with this code: ...
skr3178's user avatar