Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

Filter by
Sorted by
Tagged with
1 vote
0 answers
14 views

Exploring Amino Acid Patterns in Proteins Through N-gram Analysis [closed]

In our recent research, we delved into the amino acid composition of protein sequences by applying n-gram analysis techniques. By examining the distribution of n-grams ranging from 1-gram to 11-gram, ...
anatol's user avatar
  • 111
4 votes
1 answer
43 views

SARS-CoV-2 sequence used in the AlphaSeq Antibody Datasets to predict binding affinity

Currently we are building a sequence based deep-learning model to predict binding affinity between antibody and antigen. For this we are training a sequence based model with AlphaSeq Antibody dataset (...
Krishna's user avatar
  • 43
1 vote
1 answer
43 views

Multi Factor in Deseq2 Gene enrichment analysis

I want to see how the gene expression differs in breast cancer between three species, and I am using DESeqDataSetFromMatrix on my count table. ...
ToTheMoon's user avatar
1 vote
2 answers
33 views

How to classify TF motifs by family

I have a FIMO output, the input sequences were putative promoter sequences of several species. I want to graph the positions of these motifs along a horizontal graph, but I want to filter the data by ...
JohnDoe23's user avatar
1 vote
0 answers
52 views

Recommendations on Motif scoring functions

I am searching for specific transcription factor binding locations on DNA, and ranking them according the their scores. For this, I am in search of a tool or method that can generate motif scores for ...
Zebra Fish's user avatar
4 votes
2 answers
65 views

probability of finding a 5 amino acids in a row within a proteome

How to calculate the probability of finding two proteins that share a 5 amino acid long motif from a proteome of around 1067 proteins that have an average length of 65 residues. The probability of a ...
saplingmagic's user avatar
2 votes
2 answers
49 views

Longstitch error make: command: Command not found *** No rule to make target

I installed Longstitch and ran the test script with no issues. The output files matched the expected output files. But when I am now trying to run Longstitch on my own data I am getting this error. <...
Karli's user avatar
  • 21
0 votes
1 answer
34 views

What does the different sequences represent?

I am using this package nsdpy to download genome sequences from NCBI nucleotide database. Specifically I am interested in the whole mitochondrial genome of different species, here I will use a subset ...
Mirko's user avatar
  • 267
3 votes
1 answer
209 views

Trimmomatic QC report shows drop in the reads and presence of overrepresented sequences

This question was also asked on Biostars I am performing a de novo genome assembly using Illumina paired-end short reads, sequenced on a NovaSeq X by our collaborator at UCLA. At present, I am in the ...
Vijith Kumar V's user avatar
0 votes
1 answer
80 views

How to find amino acid sequence of a given protein

Is there a way to look up the amino acid sequence of a given protein? For example, what amino acids are used to produce Amylase? I spent hours googling but to no avail. If that's impossible, how can I ...
Nemo's user avatar
  • 111
2 votes
2 answers
71 views

paired-end short reads: will one file suffice?

I have a quick question about paired-end short reads. I have multiple genomes that were sequenced with paired-end Illumina NextSeq 200 technology, resulting in two fastq files per sample: ...
rimo's user avatar
  • 963
1 vote
0 answers
37 views

Finding mutations in glycosylation sites

We are going to look at the likely N- and O- glycosylation sites within MUC16 (Q8WXI7 · MUC16_HUMAN)§ by in house long-read DNA sequencing data (PacBio). Counting the number of tandem repeats is a ...
Zizogolu's user avatar
  • 2,148
-1 votes
1 answer
72 views

stats.sh error in BBmap package

I am trying to calculate the N50 value from the assembled FASTA file. I used stats.sh from the BBmap package. I executed the following command ...
seq's user avatar
  • 9
-1 votes
1 answer
55 views

Is there a data analysis software (free) or code that I can use to view normalized CDR3 amino acid length distributions?

Is there a data analysis software (free) or code that I can use to view normalized CDR3 amino acid length distributions? Regarding code, preferably using Python or R. EDIT: Added a picture of the non-...
SData11's user avatar
3 votes
2 answers
126 views

missed cleavages combinations generation

I am looking for an R based solution to the following problem: Trypsin does not cleave perfectly in proteomics experiments. So starting from a protein sequence FASTA I want to generate all possible ...
Klemens Fröhlich's user avatar
1 vote
0 answers
76 views

Can files with different R1 and R2 lengths be trusted?

I received paired end amplicon sequence from a LAB with different lengths for R1 (320) and R2(280). Should I trust this lab to sequence other samples? Also, I had to do a trimming over the R2 at 220(...
abi's user avatar
  • 11
1 vote
0 answers
82 views

Bracken not working

I have some highly contaminated ancient DNA sequences. I have adapter removed and collapsed these and run them through Kraken2. The Kraken reports show multiple levels of taxa with good numbers of ...
Andy Walton's user avatar
0 votes
0 answers
20 views

What statistical analysis should I perform on DNA variants from unequal number of case (34) and control (11) samples?

I have performed NGS on 34 patient samples and 11 controls. Now I have variants from both groups but there is obvious difference in number of variants. How can I compare variants of both groups ...
Malik Saad's user avatar
1 vote
2 answers
110 views

How many protein sequences do we usually have for each species?

My question is exactly the one in the title. I add a particular example for more clarity. If I want to study the sequence of protein IkBα, do I find only one sequence or is there a database that ...
HelpNeederStudent's user avatar
0 votes
1 answer
59 views

What do the numbers mean in these RNA-Seq gene/transcript TPM files?

From the link https://gtexportal.org/home/datasets, under V7, I'm trying to do R/Python analyses on the Gene TPM and Transcript TPM files. But in these files (and to open them I had to use Universal ...
Macromind101's user avatar
4 votes
1 answer
131 views

How can I make this Biopython program (to correct erroneous barcodes) run faster, and is there any alternative method?

This question has also been asked on Biostars I am looking forward to getting a valuable suggestion for a bioinformatic problem. Background: Currently, I am performing a de novo whole genome assembly. ...
VIJITH KUMAR's user avatar
-2 votes
1 answer
360 views

How to calculate Allele frequency from vcf file

Organism under investigation is Plasmodium falciparum. How to calculate the allele frequency for each row? I tried with this code: ...
skr3178's user avatar
2 votes
1 answer
37 views

Which non-matching DNA bases clash the least?

I am building primers for LAMP which I know will not match all my target sequences perfectly. To some extent, having primers with multiple variants at variable sites (degenerate primers) and longer ...
Laura's user avatar
  • 909
2 votes
1 answer
131 views

Math on Pandas Columns

I have a pandas dataframe that reads in a PAF file from minimap2. What I would like to do is take the first 5 columns of the data from to create a BED file. I used this to extract the first 5 columns: ...
rimo's user avatar
  • 963
2 votes
1 answer
74 views

Is there a graphical/interactive 16S rRNA clustering method?

I've been doing phylogenetics with large (hundreds) 16S rRNA sequences lately. Usually I'm focusing on one order, and using a combination of trees and sequence similarity to assess stuff like 'is this ...
Laura's user avatar
  • 909
0 votes
1 answer
124 views

How do I build the MinusB database for Kraken2? (Taxonomy issues)

I am attempting to build my own custom database for Kraken2. I have two questions: If I have the MCPyV genome in a file called MCPyV.fasta, how do I build a database with just this? How do I build ...
InterestingQuestions61's user avatar
2 votes
1 answer
82 views

How do I measure the proportion of different bacteria in a sample from a high-throughput sequencer?

[this question is based on a question that was asked on Reddit] I have sequenced some [mostly cell-free] DNA from a sputum sample on a nanopore sequencing machine, and would like to know what is in it ...
gringer's user avatar
  • 14.1k
4 votes
2 answers
211 views

Searching motifs in sequence and their frequencies

This is a two part question. I am searching for a motif, and in that search I wanted to also find the total number of sequences in my FASTA file, but the code I wrote is not yielding that please see ...
thole's user avatar
  • 143
1 vote
1 answer
85 views

Maximum likelihood estimation for tree construction

Could someone direct me to a resource (textbook chapter, lecture notes, online video, etc.) that demonstrates, in a mathematically or computationally rigorous way, how to use maximum likelihood ...
DataScienceNovice's user avatar
1 vote
0 answers
34 views

Could someone help me understand if all sample within this are control group?

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE117872 I'm teaching myself sequence analysis. This is the count data: and then this is, what I believe to be, the coldata: All I want to know is ...
Antonio's user avatar
  • 129
0 votes
3 answers
88 views

Analysis of 4665 proteins in String database

Background I have a data set of 4665 proteins from Phytophthora cactorum and want to analyze them in the String database as other database does not have Phytophthora cactorum for GO or KEGG analysis. ...
Bikal's user avatar
  • 1
1 vote
1 answer
204 views

What are the columns in bedtools coverage output hist file?

I am using bedtools to caculate the coverage of my targets of my WES data, to later plot. But to plot, I need to know what to plot and what it is I am seeing. I have unsuccefully tried to find what ...
Dandelion's user avatar
  • 313
1 vote
2 answers
93 views

Summing up data effectively in excel

I have some tsRNA count data in excel which I need to add selectively in blocks based on the count ...
Aranyak Goswami's user avatar
2 votes
1 answer
122 views

need bam file for pilon

I just ran an assembly on yeast genomes using Flye and I want to polish those assemblies with Pilon but it requires a sorted BAM file. How do I make a BAM file of the resulting assembled.fasta?
rimo's user avatar
  • 963
1 vote
0 answers
99 views

Simple template for calculating Shannon diversity index from FASTQ files with R

I have a bunch of files in FASTQ format and need to calculate the Shannon diversity index from all of them. Is there a simple way to do that with R, some kind of step-by-step recipe? My problem is not ...
vonjd's user avatar
  • 111
1 vote
1 answer
310 views

reverse translation from amino acid string to DNA strings

what is the opposite of .translate() function calls ? I mean let's say I am given an amino acid string CYCLIC, how do I obtain all the possible combinations of DNA ...
kevin's user avatar
  • 141
2 votes
1 answer
657 views

What is the different between the I-TASSER, phyre2, SWISS-model in the 3D tertiary structure?

What is the difference between the I-TASSER, phyre2, and SWISS-model in the 3D tertiary structure? How do they get the results? When I did a prediction, I got a similar result for the highest template ...
Sewar Khassawneh's user avatar
0 votes
0 answers
129 views

Locate the saved template of minknow

I am using minknow on ubuntu. After saving the template (settings), where is that file locally stored in the system? Also what is its format/extension?
K.Harini's user avatar
2 votes
1 answer
420 views

Samtools sort: most efficient approach to sort a single sample after aligning split .fastq files

Related to my other question (Samtools sort: most efficient memory and thread settings for many samples on a cluster), we need to optimize samtools sort as we ...
Mark Ebbert's user avatar
  • 1,354
3 votes
2 answers
4k views

Samtools sort: most efficient memory and thread settings for many samples on a cluster

We're preparing to analyze thousands of .bam files beginning with re-alignment, sorting, etc. Complicated question: Has anyone investigated the optimal thread and ...
Mark Ebbert's user avatar
  • 1,354
2 votes
1 answer
521 views

How to run MD5 check for multiple fastq files in different subdirectories?

I have received Illumina sequencing reads for 100 samples. I have 8 R1.fastq.gz and 8 R2.fastq.gz files for each sample in each ...
Anik Dutta's user avatar
1 vote
1 answer
38 views

How to rescale a function?

When we have a function which takes values ​​in [a,b] and which returns values ​​in [c,d], what transformation can we do so that the function takes values ​​in [0,1] and returns values ​​in [0,1] ...
user14989's user avatar
1 vote
1 answer
731 views

tensorflow nn_model for DNA sequences: Matrix size-incompatible: In[0]: [2,1], In[1]: [784,300]

Hope anyone can help a beginner here. I'm building a proof-of concept tensorflow classifier for DNA sequences. However, the NN model does not let through train and test vectors saying the matrix size ...
monade's user avatar
  • 11
0 votes
1 answer
69 views

How to improve a genome assembly using Dovetail and PacBio assembly?

I have more of a conceptual question. I have two genome assemblies from the same plant, one from Dovetail technology (~998 Gb) and another is PacBio HiFi assembly (~1.1 Gb). The Dovetail assembly is ...
Anik Dutta's user avatar
1 vote
2 answers
178 views

Help with MinION sequencing data species identification

Hi I'm new to bioinformatics and have just completed my first run on the MinION (long read sequencing Oxford Nanopore Technologies). I was hoping someone could direct me towards R packages, workflow, ...
jack's user avatar
  • 13
1 vote
1 answer
449 views

Why does randomized motif search work?

I'm looking for intuition for why a randomized motif search works. My current thinking is as follows: We are selecting many random kmers from our DNA sequences. The chosen kmers will bias the profile ...
Moo's user avatar
  • 127
1 vote
1 answer
42 views

How should I downsample and normalize R1s and R2s and incorporate this into Lexogen's QSPA tool

I am using Lexogen's Quantitative Sequencing Pool Analysis tool (here: https://github.com/Lexogen-Tools/quantseqpool_analysis) to analyze R1 and R2 files. I have been able to successfully run this ...
Allen Schweickart's user avatar
2 votes
1 answer
51 views

How to map list items which are in groups in the dictionary values and return keys corrosponding it?

...
amardeep's user avatar
1 vote
0 answers
92 views

Downloading exon-wise gene sequence using commandline

I want to download exon-wise gene sequence of around 200 genes from NCBI. Is there anyway to do this from terminal? I have the transcript id for each sequence and I am using efetch command to download ...
Saumya Gupta 1910110's user avatar
2 votes
0 answers
32 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
iamakhilverma's user avatar