Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

20 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
1
vote
0answers
25 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
1
vote
1answer
58 views

Interpreting contig alignments to a reference genome

I have applied two de novo genome assembly tools to data from the run SRR12707453, corresponding to a phage (I downloaded the data and have no relation with the authors of the study). Using rnaSPAdes ...
1
vote
0answers
55 views

How to implement SEG (Wootton and Federhen ,1993) algorithm?

I want to implement SEG in my MATLAB environment and I'm relying on Wootton and Federhen (1993) Reading the article I cannot succeed to understand what kind of process I have to implement in order to ...
1
vote
0answers
17 views

Residue coevoution from position wise residue preferences rather than multiple sequence alignments

Hello experts in residue coevolution analysis of proteins, I am looking for a way to calculate residue coevolution (coupling scores) between all pairs of residues of a protein. The issue is that ...
1
vote
0answers
50 views

What steps should I follow for DNA analysis, for a classification problem?

I have a bed file which contains DNA sequences information as follow: ** ...
1
vote
1answer
66 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
1
vote
0answers
33 views

Available Protein sequence alignment dataset and HMM model

It may better to move the question here. I am new to biology and I find my algorithm may be used in the Protein sequence alignment, since it is a henced HMM model. I find that people use HMM to ...
1
vote
1answer
72 views

working with cutadapt

I'm working with ion torrent data where I apply the program cutadapt. I'm analyzing ITS seq data, as well as Matk. When I'm using cutadapt, I search the information for this genes, and built new ...
1
vote
0answers
37 views

Building cancer gene database

I am trying to build a database of different cancer genes i.e lung cancer, throat cancer etc. Searched through NCBI website by searching for nucleotide sequences, but I am unable to find appropriate ...
1
vote
0answers
25 views

How to use DCA to deduce the contacts between 2 proteins ensembles?

I would like to use DCA (direct coupling analysis) to analyze the interface between 2 protein ensembles (how the 2 ensembles interacts). Do you have access to a tutorial on this matter? A source code? ...
1
vote
0answers
50 views

How to rebuild the workflow for mining in oomynete genomes in UGENE

I want to recreate the UGENE workflow proposed in Convergence of retrotransposons in oomycetes and plants. After being able to understand the data and hmmsearch Here and Here and getting most of the ...
0
votes
0answers
41 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
0
votes
1answer
88 views

Converting Fastq files to Fasta files on Ubuntu

I am new to bioinformatics and programming. I tried to convert my fastq files to fasta file, but got this. What could be wrong? ...
0
votes
0answers
6 views

Can I run output from Illumina genome Analyser II, IIx and Illumina Hiseq 2000 with MetaPhlAn and HUMAnN and compare the output?

I have a dataset where some of the samples has been sequenced with Illumina Genome Analyser II, some with ...
0
votes
0answers
11 views

How to annotate ChIP peaks base on NCBI sequence name?

I have chip-seq peaks based on NCBI genome which looks like the following: ...
0
votes
0answers
21 views

Generating taxonomic hierarchy by species/genus name

I am attempting to create a reference library of DNA plant barcodes in the ITS2 barcode region for plants from a specific region (Panama). I downloaded all the sequences for plants that resulted in a ...
0
votes
0answers
23 views

Determining a Gene's Unknown Function

I'm a beginner in this field (so pardon my rudimentary knowledge/explanation) trying to understand ways on how I could potentially identify genes of unknown function. I am trying to get as close as I ...
0
votes
1answer
55 views

Arlequin files not able to converge beyond 2000 steps for some .arp files

When I use .arp files in arlequin to run mismatch distribution it says that can’t converge beyond 2000 steps and also no graphs are produced.can someone suggests what can I do to overcome this problem
0
votes
1answer
79 views

How to use extractfeat?

I am working on a script on bash linux to get the CDS (coding sequence) of a gene using extractfeat by EMBOSS. It gives me the error: Warning: No sequences written to output file I am unsure if my ...
0
votes
1answer
47 views

Error while Importing fastq sequences to jMHC software

I am trying to analyze my .fastq files (MiSeq exon reads) with the jMHC software, but output files I have obtained have no results. I think I might be doing something wrong during the first step: "...