Questions tagged [simulated-data]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1 vote
0 answers
18 views

Simulation software recommendation to confirm pipeline validity

I'm trying to detect convergent evolution in different samples of the same species. I'm just trying to see if past 20 generations the nucleotide frequency of snps under pressure converges somewhat for ...
user avatar
0 votes
0 answers
14 views

Can I use Aho-Corasick for epidemic spread simulation?

I found that with this string-finding algorithm, this algo can determine if a string(person) holds something(if he has sick, already got vaccinated, and et cetera.). I am trying to simulate an ...
user avatar
1 vote
1 answer
33 views

building complex drug-dna for AMBER software

I will appreciate if you can please clarify some of my doubts about drug-DNA complex. I want to study the drug-DNA simulation using AMBER. I did go through all the tutorials video on youtube but ...
user avatar
3 votes
1 answer
69 views

GROMACS Coordinates and velocity and force trajectories do not match accuracy

I am using GROMACS to perform MD simulations of proteins. So, I tried to record the simulation results nstxout, nstvout, and <...
user avatar
2 votes
1 answer
40 views

What are the units for the force output by nstfout, the velocity output by nstvout, and the coordinates output by nstxout in gromacs?

What are the units of force, velocity, and coordinates output by gromacs trajectory? In .mdp, they are specified by nstfout,<...
user avatar
0 votes
2 answers
59 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
user avatar
0 votes
1 answer
199 views

How to simulate phenotype from real genetic data for GWAS purpose?

I'm trying to simulate binary phenotypes from the 1000 Genome Phase 3 datasets using gcta64 --simu-cc, but no success. Everything seems to be going well, but in the end I get: ...
user avatar
7 votes
1 answer
72 views

Simulating 3' end tag-based scRNA-seq reads

Are there any tools that will simulate 3' end tag-based single-cell RNA-seq reads? For example, Drop-seq, 10X Chromium, ...
user avatar
  • 561
3 votes
1 answer
80 views

RSVSim insertions from chr1 to chr2

edit explaining python tag I would still rather have a solution based on the RSVSim package in R, but while waiting for someone who might have an answer I wanted to look at other solutions as well. ...
user avatar
  • 153
5 votes
2 answers
847 views

How to simulate nanopore reads?

I have looked already here: Tools for simulating Oxford Nanopore reads . This doesn't answer my question, because it lists a few Nanopore read simulators, but I have specific problems with each of ...
user avatar
  • 153
5 votes
3 answers
121 views

Sampling haplotypes

I am trying to simulate different genome of peoples, I have data (VCF files) of various genes from the 1000K Gene project. I want to simulate different whole genomes i.e generate a new population by ...
user avatar
8 votes
4 answers
102 views

Introduce errors in reference transcripts according to external dataset error model

I would like to modify some reference transcripts from Ensembl (D. melanogaster) to introduce a controlled rate of random errors in the sequences. The idea would be to introduce random base ...
user avatar
  • 2,646
7 votes
1 answer
594 views

How to simulate "base error rate" in art_illumina?

I'd like to simulate 10% sequencing error using art_illumina. The simulator doesn't have a parameter that I can just give the 10%, but it has this: ...
user avatar
  • 2,649
4 votes
2 answers
244 views

After artificially creating events in a FASTA file, how do I keep track of the old coordinates?

I'm beginning with the reference genome in FASTA format, hg19. I am reading the sequence into a Python dictionary with BioPython: ...
user avatar
15 votes
10 answers
2k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
user avatar
  • 2,649