Questions tagged [simulated-data]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
3
votes
1answer
40 views

GROMACS Coordinates and velocity and force trajectories do not match accuracy

I am using GROMACS to perform MD simulations of proteins. So, I tried to record the simulation results nstxout, nstvout, and <...
2
votes
1answer
31 views

What are the units for the force output by nstfout, the velocity output by nstvout, and the coordinates output by nstxout in gromacs?

What are the units of force, velocity, and coordinates output by gromacs trajectory? In .mdp, they are specified by nstfout,<...
0
votes
2answers
56 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
0
votes
1answer
117 views

How to simulate phenotype from real genetic data for GWAS purpose?

I'm trying to simulate binary phenotypes from the 1000 Genome Phase 3 datasets using gcta64 --simu-cc, but no success. Everything seems to be going well, but in the end I get: ...
4
votes
0answers
51 views

Simulating 3' end tag-based scRNA-seq reads

Are there any tools that will simulate 3' end tag-based single-cell RNA-seq reads? For example, Drop-seq, 10X Chromium, ...
3
votes
1answer
76 views

RSVSim insertions from chr1 to chr2

edit explaining python tag I would still rather have a solution based on the RSVSim package in R, but while waiting for someone who might have an answer I wanted to look at other solutions as well. ...
5
votes
2answers
698 views

How to simulate nanopore reads?

I have looked already here: Tools for simulating Oxford Nanopore reads . This doesn't answer my question, because it lists a few Nanopore read simulators, but I have specific problems with each of ...
5
votes
3answers
117 views

Sampling haplotypes

I am trying to simulate different genome of peoples, I have data (VCF files) of various genes from the 1000K Gene project. I want to simulate different whole genomes i.e generate a new population by ...
8
votes
4answers
99 views

Introduce errors in reference transcripts according to external dataset error model

I would like to modify some reference transcripts from Ensembl (D. melanogaster) to introduce a controlled rate of random errors in the sequences. The idea would be to introduce random base ...
7
votes
1answer
523 views

How to simulate "base error rate" in art_illumina?

I'd like to simulate 10% sequencing error using art_illumina. The simulator doesn't have a parameter that I can just give the 10%, but it has this: ...
4
votes
2answers
211 views

After artificially creating events in a FASTA file, how do I keep track of the old coordinates?

I'm beginning with the reference genome in FASTA format, hg19. I am reading the sequence into a Python dictionary with BioPython: ...
15
votes
9answers
2k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...