Skip to main content

Questions tagged [simulated-data]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
0 votes
0 answers
57 views

Generate simulated bam for certain snps

I want to benchmark my DNA sequencing pipeline. In order to do that I want some gold-standard files in every step(.vcf,.bam,.fastq). I want to generate/simulate a bam file of reads for a given set of ...
0 votes
1 answer
33 views

Generating simulated gold standard NGS dataset/ Any publicly available smal gold standard NGS dataset

I am trying to check my variant generation pipeline for humans. The pipeline is for NGS. I am searching for any dataset(.fastq+.bam+.vcf) for any specific sample. Now, GIAB has a nice dataset for that....
0 votes
0 answers
52 views

Protein-Protein Simulation using Gromacs

Can we do protein-protein simulation through Gromacs? if yes, can anyone teach me the correct procedure to get this done. Thank you,
1 vote
0 answers
60 views

How to identify all descendents of a branch on a phylogeny

I'm trying to simulate the evolution of binary traits on phylogenies in R to end up with a dataset of the traits held by each tip. Starting at the root, at every timestep, new traits are added with a ...
5 votes
2 answers
1k views

How to simulate nanopore reads?

I have looked already here: Tools for simulating Oxford Nanopore reads . This doesn't answer my question, because it lists a few Nanopore read simulators, but I have specific problems with each of ...
1 vote
0 answers
20 views

Simulation software recommendation to confirm pipeline validity

I'm trying to detect convergent evolution in different samples of the same species. I'm just trying to see if past 20 generations the nucleotide frequency of snps under pressure converges somewhat for ...
7 votes
1 answer
79 views

Simulating 3' end tag-based scRNA-seq reads

Are there any tools that will simulate 3' end tag-based single-cell RNA-seq reads? For example, Drop-seq, 10X Chromium, ...
0 votes
0 answers
16 views

Can I use Aho-Corasick for epidemic spread simulation?

I found that with this string-finding algorithm, this algo can determine if a string(person) holds something(if he has sick, already got vaccinated, and et cetera.). I am trying to simulate an ...
14 votes
10 answers
3k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
1 vote
1 answer
105 views

building complex drug-dna for AMBER software

I will appreciate if you can please clarify some of my doubts about drug-DNA complex. I want to study the drug-DNA simulation using AMBER. I did go through all the tutorials video on youtube but ...
3 votes
1 answer
132 views

GROMACS Coordinates and velocity and force trajectories do not match accuracy

I am using GROMACS to perform MD simulations of proteins. So, I tried to record the simulation results nstxout, nstvout, and <...
2 votes
1 answer
135 views

What are the units for the force output by nstfout, the velocity output by nstvout, and the coordinates output by nstxout in gromacs?

What are the units of force, velocity, and coordinates output by gromacs trajectory? In .mdp, they are specified by nstfout,<...
0 votes
2 answers
60 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
0 votes
1 answer
499 views

How to simulate phenotype from real genetic data for GWAS purpose?

I'm trying to simulate binary phenotypes from the 1000 Genome Phase 3 datasets using gcta64 --simu-cc, but no success. Everything seems to be going well, but in the end I get: ...
5 votes
3 answers
127 views

Sampling haplotypes

I am trying to simulate different genome of peoples, I have data (VCF files) of various genes from the 1000K Gene project. I want to simulate different whole genomes i.e generate a new population by ...
3 votes
1 answer
85 views

RSVSim insertions from chr1 to chr2

edit explaining python tag I would still rather have a solution based on the RSVSim package in R, but while waiting for someone who might have an answer I wanted to look at other solutions as well. ...
7 votes
1 answer
780 views

How to simulate "base error rate" in art_illumina?

I'd like to simulate 10% sequencing error using art_illumina. The simulator doesn't have a parameter that I can just give the 10%, but it has this: ...
8 votes
4 answers
105 views

Introduce errors in reference transcripts according to external dataset error model

I would like to modify some reference transcripts from Ensembl (D. melanogaster) to introduce a controlled rate of random errors in the sequences. The idea would be to introduce random base ...
4 votes
2 answers
273 views

After artificially creating events in a FASTA file, how do I keep track of the old coordinates?

I'm beginning with the reference genome in FASTA format, hg19. I am reading the sequence into a Python dictionary with BioPython: ...