Skip to main content

Questions tagged [simulated-data]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
14 votes
10 answers
3k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
SmallChess's user avatar
  • 2,709
1 vote
1 answer
105 views

building complex drug-dna for AMBER software

I will appreciate if you can please clarify some of my doubts about drug-DNA complex. I want to study the drug-DNA simulation using AMBER. I did go through all the tutorials video on youtube but ...
dnalectronics's user avatar