Episode #125 of the Stack Overflow podcast is here. We talk Tilde Club and mechanical keyboards. Listen now

Questions tagged [text-processing]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
2
votes
1answer
40 views

Concatenate multiple fasta files into one file per unique entry

I have eight fasta files, one per gene, with 106 fasta entries per file, like this: gene1.fasta: ...
2
votes
1answer
60 views

Is there a way to use BioLemmatizer from Python?

Lemmatization is one of the most important tasks for text normalization in NLP. One of the good lemmatizers I found for biomedical domain is BioLemmatizer. However, it is developed in Java and is ...
2
votes
1answer
39 views

how to merge two fasta based on full fasta header and remove the duplicate

I am wondering if anyone can help to merge two fasta file based on the full header as initially gene ID may be similar in some of the sequences and to remove the duplicate entry based on full fasta ...
1
vote
1answer
29 views

swap genotypes for specific fields of a vcf file

Is there a tool already established to "swap" the ref/alt information in the GT, AD and PL ...
3
votes
1answer
145 views

Fast processing of fastq data

I am trying to write python script for customized filtering for fastq file (size >3 GB). My proposed script is as follows: ...
1
vote
0answers
53 views

extracting gene names from pubmed abstracts

I have been extracted number of abstracts from pubmed. now I am having a bunch of abstracts of pubmed articles now from this abstracts I need to extract gene names which are included in abstracts.
6
votes
4answers
324 views

Identify non-coding regions from a genome annotation

I have this GTF file and I use the command below on a Linux machine to extract the coding regions of the genome: ...
6
votes
2answers
226 views

How do I re-name the headers of my Fasta file?

I appologize for asking this, but I really am really bad with regex... Can someone help me transform the headers of my fasta files from this: ...
5
votes
1answer
57 views

Is there a way to import tables in PubMed Central to MySQL or other Relational databases?

I need to use these PMC tables from the medical journals for the purpose of integrating the data with a decision-making software. Though, I can see that one can access full-text for an article from ...
3
votes
1answer
188 views

Parsing gtf file for transcript ID and transcript name

I used this previously to get ensembl ID and its gene name from the gencode gtf annotation file This was the script I used ...
1
vote
1answer
121 views

How to separate a microbial strain of MTB resistant and susceptible drugwise?

Im trying to classify my list into three type: XDR - A strain must be resistant to: ...
1
vote
1answer
34 views

Build a Pubmed query given long gene list

I would like to search the literature using the Pubmed search engine for a set of genes that are associated with a brain region of interest. Unfortunately, there are a lot of them. It's possible there ...
6
votes
5answers
348 views

Delete all 4 lines of a fastq read from a fastq file using read ID

I have the following error when running bowtie2: Error: Read HWI-D00466:116:CC62WANXX:3:1102:7363:63646 1:N:0:GCACACG has more read characters than quality values. I now want to remove all 4 ...
4
votes
2answers
146 views

How can I easily get the read size distribution of reads mapping on a certain set of regions?

Suppose I have a BAM file indicating where reads in a library have mapped, and a bed file describing a set of genomic regions. Is there a way to easily get the size distribution of the reads mapping ...
2
votes
1answer
63 views

Splitting characters of a column in repeated lines and reducing them to one line

I have a file with sample data like this: ...
4
votes
1answer
56 views

Intersecting two different files with one “master” file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
4
votes
1answer
88 views

replacing SNPs with missing calls with a specific string

I have a big file containing 27 columns and nearly 6 million rows. The following is a little example of my file ...
4
votes
2answers
138 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
4
votes
1answer
209 views

Counting a specific consecutive character with its occurrence position and length

I have a sequence file and want to count consecutive character "N", with the tandem's position of occurrence and its length. Say I have a file named mySequence.fasta...