Stack Exchange Network

Stack Exchange network consists of 174 Q&A communities including Stack Overflow, the largest, most trusted online community for developers to learn, share their knowledge, and build their careers.

Visit Stack Exchange

Questions tagged [text-processing]

The tag has no usage guidance.

2
votes
1answer
46 views

Parsing gtf file for transcript ID and transcript name

I used this previously to get ensembl ID and its gene name from the gencode gtf annotation file This was the script I used ...
0
votes
1answer
48 views

How to separate a microbial strain of MTB resistant and susceptible drugwise?

Im trying to classify my list into three type: XDR - A strain must be resistant to: ...
0
votes
1answer
19 views

Build a Pubmed query given long gene list

I would like to search the literature using the Pubmed search engine for a set of genes that are associated with a brain region of interest. Unfortunately, there are a lot of them. It's possible there ...
6
votes
5answers
101 views

Delete all 4 lines of a fastq read from a fastq file using read ID

I have the following error when running bowtie2: Error: Read HWI-D00466:116:CC62WANXX:3:1102:7363:63646 1:N:0:GCACACG has more read characters than quality values. I now want to remove all 4 ...
4
votes
2answers
58 views

How can I easily get the read size distribution of reads mapping on a certain set of regions?

Suppose I have a BAM file indicating where reads in a library have mapped, and a bed file describing a set of genomic regions. Is there a way to easily get the size distribution of the reads mapping ...
2
votes
1answer
41 views

Splitting characters of a column in repeated lines and reducing them to one line

I have a file with sample data like this: ...
4
votes
1answer
46 views

Intersecting two different files with one “master” file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
4
votes
1answer
78 views

replacing SNPs with missing calls with a specific string

I have a big file containing 27 columns and nearly 6 million rows. The following is a little example of my file ...
5
votes
2answers
102 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
4
votes
1answer
127 views

Counting a specific consecutive character with its occurrence position and length

I have a sequence file and want to count consecutive character "N", with the tandem's position of occurrence and its length. Say I have a file named mySequence.fasta...