Questions tagged [text-processing]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
3
votes
2answers
66 views

How can I obtain a list of all NCBI gene ID's along with their full name, symbol, and also known as symbols?

I would like to do two things: (1) Obtain a list of all NCBI (Entrez) gene ID's. (2) Obtain the "Official Symbol", "Official Full Name", and "Also known as" fields from ...
0
votes
0answers
32 views

merge list of datasets by row IDs in R

I have a list of dataframes with two columns each: $1 = transcript ID, $2 = expression counts (tpm), coming from import of ...
0
votes
2answers
31 views

merge rows (to columns) in R dataframe based on IDs

I have a dataframe with two columns: $1 = transcript ID, $2 = expression counts (tpm). This comes from a merging of several ...
0
votes
2answers
36 views

separate genes with expression values

I have a file like this with 2 columns. I want to separate the columns based on plus and minus signs into separate files. How do I do this with awk or sed. Kindly help.
0
votes
1answer
28 views

Protein PDB/CIF text file reader that can fold a same section into one line

Is there a software that can recognise the protein PDB/CIF files, and fold multiple lines of a same section into one line, so that it is easier to handle? I need to understand the format in CIF so as ...
1
vote
2answers
75 views

Parsing a GenBank file with multiple gene entries

Basically a GenBank file consists of gene entries (announced by 'gene') followed by its corresponding 'CDS' entry (only one per gene) like the two shown here below. I would like to extract part of the ...
-1
votes
1answer
71 views

Modifying .vcf files

I have 200 .vcf files like this on a Linux system: ...
1
vote
2answers
39 views

Remove repeated ALT allele from the REF field of a vcf-like file

I have 200 .txt files on a Linux system. In each file, I have the reference allele in the REF column and INDELs in the ...
1
vote
2answers
53 views

How to merge two files on the first 3 columns?

I have two files that look like this: ...
2
votes
1answer
287 views

Concatenate multiple fasta files into one file per unique entry

I have eight fasta files, one per gene, with 106 fasta entries per file, like this: gene1.fasta: ...
2
votes
1answer
157 views

Is there a way to use BioLemmatizer from Python?

Lemmatization is one of the most important tasks for text normalization in natural language processing (NLP), i.e. using deep learning to understand text data. One of the good lemmatizers I found for ...
2
votes
1answer
53 views

how to merge two fasta based on full fasta header and remove the duplicate

I am wondering if anyone can help to merge two fasta file based on the full header as initially gene ID may be similar in some of the sequences and to remove the duplicate entry based on full fasta ...
1
vote
1answer
50 views

swap genotypes for specific fields of a vcf file

Is there a tool already established to "swap" the ref/alt information in the GT, AD and PL ...
3
votes
1answer
177 views

Fast processing of fastq data

I am trying to write python script for customized filtering for fastq file (size >3 GB). My proposed script is as follows: ...
1
vote
0answers
78 views

extracting gene names from pubmed abstracts

I have been extracted number of abstracts from pubmed. now I am having a bunch of abstracts of pubmed articles now from this abstracts I need to extract gene names which are included in abstracts.
6
votes
4answers
416 views

Identify non-coding regions from a genome annotation

I have this GTF file and I use the command below on a Linux machine to extract the coding regions of the genome: ...
6
votes
2answers
512 views

How do I re-name the headers of my Fasta file?

I appologize for asking this, but I really am really bad with regex... Can someone help me transform the headers of my fasta files from this: ...
5
votes
1answer
100 views

Is there a way to import tables in PubMed Central to MySQL or other Relational databases?

I need to use these PMC tables from the medical journals for the purpose of integrating the data with a decision-making software. Though, I can see that one can access full-text for an article from ...
3
votes
1answer
386 views

Parsing gtf file for transcript ID and transcript name

I used this previously to get ensembl ID and its gene name from the gencode gtf annotation file This was the script I used ...
1
vote
1answer
132 views

How to separate a microbial strain of MTB resistant and susceptible drugwise?

Im trying to classify my list into three type: XDR - A strain must be resistant to: ...
1
vote
1answer
41 views

Build a Pubmed query given long gene list

I would like to search the literature using the Pubmed search engine for a set of genes that are associated with a brain region of interest. Unfortunately, there are a lot of them. It's possible there ...
6
votes
5answers
769 views

Delete all 4 lines of a fastq read from a fastq file using read ID

I have the following error when running bowtie2: Error: Read HWI-D00466:116:CC62WANXX:3:1102:7363:63646 1:N:0:GCACACG has more read characters than quality values. I now want to remove all 4 ...
5
votes
2answers
561 views

How can I easily get the read size distribution of reads mapping on a certain set of regions?

Suppose I have a BAM file indicating where reads in a library have mapped, and a bed file describing a set of genomic regions. Is there a way to easily get the size distribution of the reads mapping ...
2
votes
1answer
91 views

Splitting characters of a column in repeated lines and reducing them to one line

I have a file with sample data like this: ...
4
votes
1answer
73 views

Intersecting two different files with one “master” file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
4
votes
1answer
90 views

replacing SNPs with missing calls with a specific string

I have a big file containing 27 columns and nearly 6 million rows. The following is a little example of my file ...
4
votes
2answers
149 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
4
votes
1answer
257 views

Counting a specific consecutive character with its occurrence position and length

I have a sequence file and want to count consecutive character "N", with the tandem's position of occurrence and its length. Say I have a file named mySequence.fasta...