Stack Exchange Network

Stack Exchange network consists of 175 Q&A communities including Stack Overflow, the largest, most trusted online community for developers to learn, share their knowledge, and build their careers.

Visit Stack Exchange

Questions tagged [vcf]

VCF, acronym for Variant Calling Format, is a text file type used to store information regarding genetic variants.

3
votes
2answers
185 views

Selecting 65000 SNPs where AF is close to 0.5 in all or most populations

I am evaluating the tool somalier (https://github.com/brentp/somalier) and I need to create a list of about 65,000 SNPs where the allele frequency (AF) is as close to 0.5 as possible across the most ...
7
votes
2answers
50 views

How to check if indels in VCF files are left or right aligned?

I download a VCF file from dbSNP, and is curious if the indels in the file are left-aligned for GRCH37 genome. The documentation doesn't say anything. How can we tell if a VCF file has left or right ...
2
votes
0answers
34 views

structural variants: why doesn't AS + AP = SU?

I have run smoove then duphold on 46 individuals, then pasted the duphold output back into a squared vcf with all 46 samples. I have been using SU/AC as one of my filters, looking for variants that ...
3
votes
1answer
38 views

Sort vcf by contig and position within contig

Due to tabix constraints, I need to sort a vcf so that contigs and then positions within contigs occur in numerical order in the vcf. I don't know if the following will sort positions within contigs, ...
2
votes
0answers
27 views

R package grur: missing_visualization() fails during redundancy analysis of .vcf

I am trying to use the R package grur to process GBS SNP data, which is installed from github as instructed. For starters, I am running the test code in this vignette. As suggested I am running it ...
4
votes
1answer
53 views

Script Giving error at paste command

I wrote script for pasting rsids on CADD output. Here is script. ...
5
votes
3answers
61 views

bcftools filtering all files in a directory

Probably a silly oversight on my part, but I'm trying to filter all the vcfs in a directory with bcftools using a simple loop. My basic command is working fine: ...
3
votes
4answers
34 views

how to filter a multi-VCF for sex-specific genotypes?

I have a single VCF file of variants for a population that includes males & females and I would like to pull out all variants that are sex-specific. For example, sites where all males are 0/1 and ...
7
votes
2answers
97 views

calling diploid SNVs from long reads

I'd like to call diploid SNV variants from long-reads data (~80SMRTcells PacBio). I have generated a draft reference genome for an indivudual from a heterozygous (~4%) species (Canu+Haplomerger2). ...
3
votes
1answer
50 views

How to paste RSIDs in CADD output

I want to paste RSIDs in CADD output as CADD does not give RSID column in its output. For this purpose I am using bedtools intersect to compare two files and have RSID column in my CADD file. This is ...
0
votes
0answers
27 views

How to use FastQTL with LeafCutter?

I am following along with the example data in the LeafCutter documentation and I am a bit stuck on the final step of using FastQTL to generate QTL maps. Documentation for FastQTL is scant and so are ...
2
votes
0answers
100 views

Combine VCF files

I have a problem with using rbind to combine VCF files using the library VariantAnnotation from Bioconductor. I am reading two VCF files, when I try to combine them in a certain order with 'rbind' I'...
5
votes
3answers
85 views

Sampling haplotypes

I am trying to simulate different genome of peoples, I have data (VCF files) of various genes from the 1000K Gene project. I want to simulate different whole genomes i.e generate a new population by ...
8
votes
1answer
61 views

Best practices for deciding if two structural variants are actually the same variant?

I know that I can use bcftools isec to compare two VCF files containing single nucleotide variants (SNVs); it will generate four possible output files: one with all ...
2
votes
1answer
102 views

Simplest way to work out structural variant type?

In VCF 4.2, a strucutral variant can be described with the BND keyword in SVTYPE. For example, the following example is an ...
4
votes
2answers
228 views

No variant found using GATK 4.0 HaplotypeCaller

I am doing variant calling on RNA-seq datasets from wheat which is hexaploid,the binary alignment (BAM) files were created using STAR version 2.6.0c and variant calling was done using GATK 4.0 ...
1
vote
2answers
57 views

High Phred Quality score VCF file

I am working on ION Torrent S5 XL and I am facing to an issue with VCF output generated by the variant caller of thermofisher. It stating on VCF 4.1 that Phred Quality Score is on a range of 0 to 255. ...
3
votes
1answer
52 views

How to convert files to ADAM format?

I would like to convert BAM and VCF files to ADAM format. How do I do that?
5
votes
1answer
59 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
1
vote
0answers
33 views

Normalize by counting CNV within a pool of VCF files

I’m (trying) using the GATK4 germline CNV calling pipeline. I successfully got 57 VCFs from my sample batch, called with segments (obtained by merging the contiguous intervals), like in a classic VCF :...
2
votes
2answers
133 views

How to filter for “CAF=0.5747,0.4253”

In my gzipped VCF file I have many variants, and they report allele frequency such as: ...
2
votes
0answers
52 views

bcftools consensus not working when using -H flag

Sorry, I have been trying to work this out desparately all day. Biostars couldn't find any answer so I am cross posting here https://www.biostars.org/p/315458/#315686 . I am trying to get both the ...
2
votes
2answers
131 views

Protein sequence from patient data

Currently, I am working on NGS data and my aim is to get significance prediction of variants present in the vcf file. As we know about SIFT Score for significance score prediction, I am trying to ...
1
vote
1answer
161 views

update dbSNP ID

I have used dbSNP build 138 to tag 'rs' ID in my VCF file. But later I came to know that now dbSNP build 150 has been released. I want to update the rs IDs in my VCF file. I tried but I found a ...
1
vote
1answer
36 views

How to add OVERLAP_BP field to VEP output?

I'm using the Ensembl Variant Effect Predictor (VEP) to annotate VCF files, and I am trying to add some additional fields to the output, among these is OVERLAP_BP, ...
1
vote
0answers
88 views

Error filtering SNPs with Plink

Im trying to filter SNPs using PLINK with this command. Also, the .map and .ped files were converted to a plink format from a vcf file (...
4
votes
2answers
194 views

GATK CombineVariants complains the contig order in the VCF files

I have called variants on two strains of C. elegans separately. I now want to merge the VCF files into one using the following code: Create a sequence dictionary of the reference sequence Sort the ...
4
votes
1answer
96 views

Keep Format and Individual fields when annotating VCF with VEP

I'm currently updating my Variant Calling Pipeline by switching the VCF annotating software from Annovar to VEP for a variety of regions, not least how easy it is to annotate with HGVS notation and ...
5
votes
1answer
253 views

Merge 2 VCFs from different variant callers

I am working with WES data for detection of somatic variants and I have used two variant callers because no variant caller is complete in itself. I have used GATK Haplotypecaller for small variants ...
0
votes
0answers
43 views

Complete Genomics Junction file for SV Detection

At present, I have vcf file for each patient generated from tumor data. I am using virtual normal correction method for somatic mutation detection because I don't have normal data. For SNP or small ...
8
votes
2answers
856 views

Converting a BAM file into VCF

I have NGS illumina RNA-seq reads from M. musculus (mm10). I am trying to find variants along the strand portion of the reads in the refseq (mm10). I mapped a pair of sequence files and generated a ...
2
votes
1answer
75 views

How to get unique somatic mutations for each individual patients

I have exome data 32 patients. My aim is to identify unique somatic mutations in each patients. For this I have completed my pipeline for Whole Exome Data analysis using various tools like BWA mem, ...
5
votes
1answer
2k views

Converting VCF file to PLINK bed/bim/fam files

I am trying to find the best way to convert VCF files to PLINK binary bed/bim/fam files, but it seems like there are many varied ways to do this. (For example, using Plink 1.9 --vcf tag, bcftools, ...
4
votes
1answer
110 views

Can a data file in VCF format be converted into FASTA?

I'm considering purchasing the 'MyGenome' product by Veritas Genetics to analyze my genome for a project. I'd like the data to be in FASTA format, but Veritas only provides VCF data. Is it possible to ...
2
votes
0answers
51 views

Post ipyrad filtering of SNP loci from GBS, based on SNP quality

I want to use SNPs produced by ipyrad analysis of GBS data in RAxML to examine the monophyly of a highly-variable focal species and its phylogenetic relationships with about 40 congeners. An initial ...
2
votes
2answers
1k views

How to subset samples from a VCF file?

I have VCF files (SNPs & indels) for WGS on 100 samples, but I want to only use a specific subset of 10 of the samples. Is there a relatively easy way to pull out only the 10 samples, while still ...
3
votes
1answer
724 views

Tools to do VCF to MAF and MAF to VCF conversion?

Normally, I would use the vcf2maf scripts to convert a VCF to a MAF (or vice versa). This is great software, but on my system, perl scripts with dependencies are easy to break. (Here it uses VEP.) ...
3
votes
2answers
1k views

How to subset a VCF by chromosome and keep the header?

I would like to subset a VCF which only has chromosome 2. The problem with using various grep commands, e.g. ...
2
votes
3answers
1k views

How to concatenate “by chromosome”-VCFs?

I have a several VCFs which are VCF which only contain information by chromosome. That is, there's a chromosome 1 VCF (with only chr1), a chromosome 2 VCF (with only chr2), etc. I checked to make ...
7
votes
1answer
148 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
1
vote
2answers
180 views

Approximate matches with bedtools intersect

I am using bedtools to test whether a set of variant calls produced by a new method is missing any variants from a set of known validated variants. ...
4
votes
1answer
48 views

Intersecting two different files with one “master” file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
5
votes
2answers
112 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
5
votes
3answers
190 views

How to indicate the END of a haplotype block in VCF?

In VCF I know how to indicate that two genotypes are in the same phase by using consecutive "0|1" and "1|0" genotype fields, for example. However, how do I deal with the case that the first two ...
4
votes
1answer
572 views

Using Python, how to convert a pandas DataFrame into a VCF?

Let's say I have a pandas dataframe with fields CHROM, POS, ALT, ...
3
votes
1answer
116 views

Where can I get the population allele frequency vcf file?

I want to use GATK to Estimate cross-sample contamination for Whole Genome Sequencing data. The specific tool is ContEst and it is run with: ...
4
votes
1answer
73 views

Is it possible to check if a patient has the HLA-B27 antigen from his exome stored in a VCF file

Is it possible to check if patient has the HLAB27 antigen by comparing his exome stored in VCF with all known HLAB27 variants? For instance, rs4349859 is a known HLAB27 SNP. If I can find rs4349859 ...
2
votes
2answers
288 views

bcftools output vs. bgzip

I've got what seems like it should be a simple question, but I can't seem to figure it out from google. bcftools has 4 output options: ...
6
votes
2answers
2k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
6
votes
4answers
185 views

Any fast options to query large VCF bed intervals?

I'm doing some analysis and I need to subset a large VCF file (~8GB gziped) given a bed interval and identify within a subset of rsid. Unfortunately, both my normal choices to do this analysis (<...