Questions tagged [vcf]

VCF, acronym for Variant Calling Format, is a text file type used to store information regarding genetic variants.

Filter by
Sorted by
Tagged with
11
votes
2answers
12k views

Converting VCF file to PLINK bed/bim/fam files

I am trying to find the best way to convert VCF files to PLINK binary bed/bim/fam files, but it seems like there are many varied ways to do this. (For example, using Plink 1.9 --vcf tag, bcftools, ...
11
votes
3answers
6k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
8
votes
2answers
7k views

Converting a BAM file into VCF

I have NGS illumina RNA-seq reads from M. musculus (mm10). I am trying to find variants along the strand portion of the reads in the refseq (mm10). I mapped a pair of sequence files and generated a ...
4
votes
2answers
664 views

Why are there missing calls in a VCF file from exome sequencing?

My data is a VCF file generated from an exome sequencing variant call pipeline. I'm not very familiar with the sequencing and variant calling process. I noticed that there are some missing genotypes, ...
4
votes
1answer
373 views

Are duplicate variants against the VCF standard?

I have been trying to understand an error that the EBI's vcf_validator gives when run on my vcf file. Consider this minimal file: ...
0
votes
2answers
126 views

Changing this code in a way to work for my files

I have a bash script which extracts some information from a .vcf file but one .vcf file at each time. How I can change this script in a way to work on a bunch of .vcf files and the output is a .txt ...
0
votes
2answers
131 views

Looping over several files in bash

I have a bash script: I am wondering how I can change this script to loop over a bunch of .vcf files and give output .txt with the name of corresponding .vcf I tried changes done in similar script ...
0
votes
1answer
127 views

what is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets?

What is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets nowadays? About 5 years or so ago, it used to be the latest release of the CSHL ...
8
votes
4answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
7
votes
1answer
619 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
4
votes
2answers
155 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
2
votes
2answers
431 views

How to filter for "CAF=0.5747,0.4253"

In my gzipped VCF file I have many variants, and they report allele frequency such as: ...
1
vote
3answers
147 views

Masking sites in a vcf file

I need to mask all sites in a vcf file flagged by the 1000 Genomes Project as being unfit for population genetic analyses. The sites for all chromosomes are available at: 1000Genomes masked sites From ...
0
votes
1answer
298 views

Making PLINK compatible files from VCF file without phenotype information

I have a big VCF file that I need to convert to, preferably, bed/bim/fam files that are readable by plink. Currently using plink 2. I am aware that this version of plink can be used to convert VCFs ...