Questions tagged [vcf]

VCF, acronym for Variant Calling Format, is a text file type used to store information regarding genetic variants.

Filter by
Sorted by
Tagged with
12 votes
2 answers
17k views

Converting VCF file to PLINK bed/bim/fam files

I am trying to find the best way to convert VCF files to PLINK binary bed/bim/fam files, but it seems like there are many varied ways to do this. (For example, using Plink 1.9 --vcf tag, bcftools, ...
Sarah's user avatar
  • 496
4 votes
1 answer
643 views

Are duplicate variants against the VCF standard?

I have been trying to understand an error that the EBI's vcf_validator gives when run on my vcf file. Consider this minimal file: ...
terdon's user avatar
  • 10.1k
11 votes
3 answers
7k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
ShanZhengYang's user avatar
9 votes
2 answers
761 views

How to import a large amount of .bed, .gff, .vcf, .paf, .sam files into an SQL database?

Are there best practices to load different bioinformatics file formats such as VCF, BED, GFF, and SAM to SQL databases? I am wondering how people out there do that efficiently. All of these three ...
0x90's user avatar
  • 1,437
9 votes
2 answers
12k views

Converting a BAM file into VCF

I have NGS illumina RNA-seq reads from M. musculus (mm10). I am trying to find variants along the strand portion of the reads in the refseq (mm10). I mapped a pair of sequence files and generated a ...
Lou_A's user avatar
  • 361
8 votes
2 answers
7k views

How is the GT field in a VCF file defined?

As my question in SO was closed and asked to be posted in this forum, I am posting it here. I am not from the bioinformatics domain. However, for the sake of analysis, I am trying to pick up certain ...
The Great's user avatar
  • 227
8 votes
4 answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
ShanZhengYang's user avatar
7 votes
1 answer
822 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
719016's user avatar
  • 2,324
7 votes
1 answer
2k views

Merge 2 VCFs from different variant callers

I am working with WES data for detection of somatic variants and I have used two variant callers because no variant caller is complete in itself. I have used GATK Haplotypecaller for small variants ...
Lot_to_learn's user avatar
6 votes
1 answer
1k views

Why does GATK produce both 0/1 and 1/0 genotypes in the same file? Are the two not equivalent?

I have always thought that 1/0 and 0/1 in VCF genotype fields are equivalent. And yet, GATK uses both. For example, these are ...
terdon's user avatar
  • 10.1k
5 votes
2 answers
3k views

How can I remove (non-trivial) duplicates from a VCF file?

This is related to the question I asked here. Consider a vcf file that contains duplicate variants, but where the duplicates aren't simply the same thing in the same notation but instead one is a ...
terdon's user avatar
  • 10.1k
4 votes
2 answers
1k views

Why are there missing calls in a VCF file from exome sequencing?

My data is a VCF file generated from an exome sequencing variant call pipeline. I'm not very familiar with the sequencing and variant calling process. I noticed that there are some missing genotypes, ...
Yan's user avatar
  • 143
4 votes
2 answers
168 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
rishi's user avatar
  • 353
2 votes
0 answers
185 views

Assess ploidy estimation through SNV and CNV results

I want to assess ploidy estimation (i.e., diploid vs tetraploid) in a set of samples for which I have both results from the variant caller (i.e., SNVs) and from the copy number caller. What are the ...
gc5's user avatar
  • 1,783
2 votes
2 answers
585 views

How to filter for "CAF=0.5747,0.4253"

In my gzipped VCF file I have many variants, and they report allele frequency such as: ...
SmallChess's user avatar
  • 2,699
1 vote
1 answer
940 views

Making PLINK compatible files from VCF file without phenotype information

I have a big VCF file that I need to convert to, preferably, bed/bim/fam files that are readable by plink. Currently using plink 2. I am aware that this version of plink can be used to convert VCFs ...
MHiller's user avatar
  • 11
1 vote
3 answers
913 views

Masking sites in a vcf file

I need to mask all sites in a vcf file flagged by the 1000 Genomes Project as being unfit for population genetic analyses. The sites for all chromosomes are available at: 1000Genomes masked sites From ...
John's user avatar
  • 115
0 votes
1 answer
37 views

Is it valid VCF not to 'squash' positions with more than one ALT allele?

I'm seeing output from PBWT that looks like this: ...
Dan Bolser's user avatar
0 votes
1 answer
194 views

what is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets?

What is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets nowadays? About 5 years or so ago, it used to be the latest release of the CSHL ...
719016's user avatar
  • 2,324
0 votes
2 answers
197 views

Changing this code in a way to work for my files

I have a bash script which extracts some information from a .vcf file but one .vcf file at each time. How I can change this script in a way to work on a bunch of .vcf files and the output is a .txt ...
Zizogolu's user avatar
  • 2,148
0 votes
2 answers
213 views

Looping over several files in bash

I have a bash script: I am wondering how I can change this script to loop over a bunch of .vcf files and give output .txt with the name of corresponding .vcf I tried changes done in similar script ...
Zizogolu's user avatar
  • 2,148