Questions tagged [vcf]

VCF, acronym for Variant Calling Format, is a text file type used to store information regarding genetic variants.

Filter by
Sorted by
Tagged with
16
votes
5answers
7k views

Is there an easy way to create a summary of a VCF file (v4.1) with structural variations?

I got a bunch of vcf files (v4.1) with structural variations of bunch of non-model organisms (i.e. there are no known variants). I found there are quite a some tools to manipulate vcf files like ...
14
votes
5answers
2k views

How do I carry out an ancestry/admixture test on a single VCF file?

This is a question from /u/beneficii9 on reddit. The original post can be found here. Through the Personal Genome Project, I have had my whole genome sequenced by Veritas, and have it in the form of ...
13
votes
1answer
3k views

What's the difference between VCF spec versions 4.1 and 4.2?

What are the key differences between VCF versions 4.1 and 4.2? It looks like v4.3 contains a changelog (specs available here) but earlier specifications do not. This biostar post points out one ...
13
votes
3answers
346 views

Given a VCF of a human genome, how do I assess the quality against known SNVs?

I'm looking for tools to check the quality of a VCF I have of a human genome. I would like to check the VCF against publicly known variants across other human genomes, e.g. how many SNPs are already ...
13
votes
2answers
1k views

How to read structural variant VCF?

The IGSR has a sample for encoding structural variants in the VCF 4.0 format. An example from the site (the first record): ...
11
votes
3answers
17k views

How to subset samples from a VCF file?

I have VCF files (SNPs & indels) for WGS on 100 samples, but I want to only use a specific subset of 10 of the samples. Is there a relatively easy way to pull out only the 10 samples, while still ...
11
votes
3answers
6k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
11
votes
2answers
12k views

Converting VCF file to PLINK bed/bim/fam files

I am trying to find the best way to convert VCF files to PLINK binary bed/bim/fam files, but it seems like there are many varied ways to do this. (For example, using Plink 1.9 --vcf tag, bcftools, ...
10
votes
3answers
1k views

Tools to create annotated table of variants from VCF

The problem: I have a VCF file, a reference genome, and a bunch of annotations for the reference (genes, repeat regions, etc.) as GFF or BED files. What I would like is a tool that takes all of this ...
9
votes
3answers
1k views

Selecting sites from VCF which have an alt AD > 10

I have high-depth variant calling created using the HaplotypeCaller with --output_mode EMIT_ALL_SITES I'm interested in finding all sites (regardless of genotype ...
9
votes
2answers
260 views

calling diploid SNVs from long reads

I'd like to call diploid SNV variants from long-reads data (~80SMRTcells PacBio). I have generated a draft reference genome for an indivudual from a heterozygous (~4%) species (Canu+Haplomerger2). ...
9
votes
1answer
96 views

Best practices for deciding if two structural variants are actually the same variant?

I know that I can use bcftools isec to compare two VCF files containing single nucleotide variants (SNVs); it will generate four possible output files: one with all ...
8
votes
4answers
916 views

Are variant calling files personally identifiable information?

This question is to be read in the context of data protection. It seems to be common understanding that the whole genome sequence of an individual is personally identifiable, non-anonymizable ...
8
votes
2answers
7k views

Converting a BAM file into VCF

I have NGS illumina RNA-seq reads from M. musculus (mm10). I am trying to find variants along the strand portion of the reads in the refseq (mm10). I mapped a pair of sequence files and generated a ...
8
votes
4answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
8
votes
5answers
2k views

How can I extract only insertions from a VCF file?

I'm looking to subset a standard VCF file to generate one which only includes insertions (i.e. not indels). I can get part of the way there with: ...
8
votes
2answers
4k views

Tools to do VCF to MAF and MAF to VCF conversion?

Normally, I would use the vcf2maf scripts to convert a VCF to a MAF (or vice versa). This is great software, but on my system, perl scripts with dependencies are easy to break. (Here it uses VEP.) ...
8
votes
3answers
2k views

How to convert the .vcf (imputed) file with GT:GP format to GT:DS?

I have the genotyped data from impute2 output in .gen format (imputed to 1000G P3). The file has genotype posterior probabilities (GP:3 values per variant). I have converted .gen to .vcf using qctools ...
8
votes
3answers
224 views

How to import large .bed, .gff, .vcf, .paf, .sam files into an SQL database?

Are there best practices to load different bioinformatics file formats such as VCF, BED, GFF, and SAM to SQL databases? I am wondering how people out there do that efficiently. All of these three ...
7
votes
2answers
417 views

How to check if indels in VCF files are left or right aligned?

I downloaded a VCF file from dbSNP, and I'm curious if the indels in the file are left-aligned for GRCH37 genome. The documentation doesn't say anything. How can we tell if a VCF file has left or ...
7
votes
1answer
619 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
7
votes
2answers
432 views

VCF merge containing CNV

How do I merge VCFs files containing CNVs? I use vcf-merge, a VCFtools function, and after bgzip and tabix, SAMtools, to index and tab separate variants, but I don't know if it is the right way.
6
votes
3answers
396 views

GRCh38 vcf file with common cancer mutations

Is there a vcf file on the GRCh38 assembly with common cancer mutations I can download somewhere? Maybe from one of the big international cancer genomics consortia? By common, I mean whichever ...
6
votes
4answers
528 views

Any fast options to query large VCF bed intervals?

I'm doing some analysis and I need to subset a large VCF file (~8GB gziped) given a bed interval and identify within a subset of rsid. Unfortunately, both my normal choices to do this analysis (<...
6
votes
1answer
1k views

Merge 2 VCFs from different variant callers

I am working with WES data for detection of somatic variants and I have used two variant callers because no variant caller is complete in itself. I have used GATK Haplotypecaller for small variants ...
6
votes
2answers
291 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
5
votes
3answers
7k views

How to concatenate "by chromosome"-VCFs?

I have a several VCFs which are VCF which only contain information by chromosome. That is, there's a chromosome 1 VCF (with only chr1), a chromosome 2 VCF (with only chr2), etc. I checked to make ...
5
votes
3answers
325 views

bcftools filtering all files in a directory

Probably a silly oversight on my part, but I'm trying to filter all the vcfs in a directory with bcftools using a simple loop. My basic command is working fine: ...
5
votes
2answers
1k views

No variant found using GATK 4.0 HaplotypeCaller

I am doing variant calling on RNA-seq datasets from wheat which is hexaploid,the binary alignment (BAM) files were created using STAR version 2.6.0c and variant calling was done using GATK 4.0 ...
5
votes
2answers
2k views

bcftools output vs. bgzip

I've got what seems like it should be a simple question, but I can't seem to figure it out from google. bcftools has 4 output options: ...
5
votes
2answers
4k views

Sort vcf by contig and position within contig

Due to tabix constraints, I need to sort a vcf so that contigs and then positions within contigs occur in numerical order in the vcf. I don't know if the following will sort positions within contigs, ...
5
votes
1answer
1k views

How to represent a deletion at position 1 in a VCF file?

I am writing a small script to write a VCF file from short multiple sequence alignments, and stumbled into an interesting corner case. This is the way a deletion should be represented in VCF format (...
5
votes
2answers
2k views

How can I remove (non-trivial) duplicates from a VCF file?

This is related to the question I asked here. Consider a vcf file that contains duplicate variants, but where the duplicates aren't simply the same thing in the same notation but instead one is a ...
5
votes
1answer
143 views

Bash script error at paste command

I wrote script for pasting rsids on CADD output. Here is script. ...
5
votes
3answers
420 views

How to indicate the END of a haplotype block in VCF?

In VCF I know how to indicate that two genotypes are in the same phase by using consecutive "0|1" and "1|0" genotype fields, for example. However, how do I deal with the case that the first two ...
5
votes
3answers
117 views

Sampling haplotypes

I am trying to simulate different genome of peoples, I have data (VCF files) of various genes from the 1000K Gene project. I want to simulate different whole genomes i.e generate a new population by ...
5
votes
1answer
355 views

Can a data file in VCF format be converted into FASTA?

I'm considering purchasing the 'MyGenome' product by Veritas Genetics to analyze my genome for a project. I'd like the data to be in FASTA format, but Veritas only provides VCF data. Is it possible to ...
5
votes
1answer
1k views

Is there a standard tool used to convert a VCF to a BEDPE?

Many popular SV callers output a VCF. Unfortunately, there isn't a unified system at the present to label events with the same notation. However, is there a standard method for converting these VCFs ...
5
votes
1answer
227 views

Searching tool to calculate phase/switch error rate

I'm looking for a tool which, given a truth vcf file and a test vcf file, calculates the phase/switch error rate. I performed phasing of a vcf using WhatsHap and want to compare the outcome to some ...
5
votes
1answer
691 views

Simplest way to work out structural variant type?

In VCF 4.2, a structural variant (SV) can be described with the BND keyword in SVTYPE. For example, the following example is an ...
5
votes
1answer
204 views

vcftools: indel size histogram command returns empty file

I would like to get some summary statistics on a vcf file from one individual, which has over a million variant calls. I've tried to make a histogram of indel sizes with this command, ...
4
votes
1answer
3k views

Using Python, how to convert a pandas DataFrame into a VCF?

Let's say I have a pandas dataframe with fields CHROM, POS, ALT, ...
4
votes
2answers
664 views

Why are there missing calls in a VCF file from exome sequencing?

My data is a VCF file generated from an exome sequencing variant call pipeline. I'm not very familiar with the sequencing and variant calling process. I noticed that there are some missing genotypes, ...
4
votes
1answer
373 views

Are duplicate variants against the VCF standard?

I have been trying to understand an error that the EBI's vcf_validator gives when run on my vcf file. Consider this minimal file: ...
4
votes
1answer
219 views

Where can I get the population allele frequency vcf file?

I want to use GATK to estimate cross-sample contamination for Whole Genome Sequencing data. The specific tool is ContEst and it is run with: ...
4
votes
2answers
284 views

Is there a way to quickly verify the presence of some SNPs in Fastq files?

Is there a tool that can scan fastq files without assembling them for a custom list of user defined snps?
4
votes
2answers
729 views

GATK CombineVariants complains the contig order in the VCF files

I have called variants on two strains of C. elegans separately. I now want to merge the VCF files into one using the following code: Create a sequence dictionary of the reference sequence Sort the ...
4
votes
1answer
278 views

Keep Format and Individual fields when annotating VCF with VEP

I'm currently updating my Variant Calling Pipeline by switching the VCF annotating software from Annovar to VEP for a variety of regions, not least how easy it is to annotate with HGVS notation and ...
4
votes
1answer
80 views

Intersecting two different files with one "master" file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
4
votes
2answers
155 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...