9

If you check the read QC statistics of an Illumina run in e.g. fastQC, you will see that at the end of the read the quality decreases. This is because of exhaustion of chemicals at the end of the run. This is a general trend seen in all runs, therefore you can remove these low quality bases from the end of your run. If you have incidentally a bad quality ...


9

Things like this might depend on your specific library prep, but in general: sequencing starts at the end of the adapter, not before it. You will only see adapters if you sequence through the entire fragment into the adapters on the other side. If your fragment is long enough you won't see any adapter, and of course, that's the desirable outcome of your ...


6

I am commenting on this part: The algorithm only removes low quality bases from the end until it reaches a good quality base. If there is a bad quality base beyond that, it is not trimmed. According to its user guide, cutadap is designed this way: it trims off bases from the 3'-end until it sees a base with quality higher than a threshold. This is not a ...


5

The adapter sequence you have googled is the sequence on the adapter primer. This works when you want to remove primer-dimers. With transposase adapters or ATAC seq, you have very short fragments and you sequence into the adapter. So what you is sequenced is actually the reverse complement. See below image from trimmomatic manual So if you look at what ...


3

I cannot quite help(*) on the problem you are having with cutadapt but can point you out to Trimmomatic, for which the developers have been granted permission to distribute Illumina adapter sequences. If you download Trimmomatic, you will see a bunch of Illumina adapter sequence files in the /trimmomatic-0.39/adapters/ folder. Actually the adapter sequence ...


2

Try this one for file in /dir/* do cutadapt -g ACTTAAGTGTATGTAAACTTCCGACTTCAACTG "$file" >> results.out done Also you have omitted --discard-untrimmed from the original command. If you want that as well along with everything to run in parallel: for file in /dir/* do cutadapt -g ACTTAAGTGTATGTAAACTTCCGACTTCAACTG --discard-untrimmed "$file" -o "`...


2

I came across the same problem of Nextera transposase contamination in my shotgun metagenome sequence. I specified the library in trimmomatic and Nextera transposase adapters were successfully removed. Please see the code below: java -jar /opt/software/Trimmomatic/0.39-Java-1.8/trimmomatic-0.39.jar PE -phred33 1004_R1.fastq.gz 1004_R2.fastq.gz ../QC_data/...


1

First of all, you aren't actually setting the $outfile variable. Your loop has this basic format: for var in *; do newVar="something" command $newVar; done For example: $ for var in 1 2 3 4; do newVar="new:$var" echo "$var: $newVar"; done 1: 2: 3: 4: As you can see, newVar is never actually being set. That's because setting a ...


1

For Illumina (and 454) reads, the quality decreases with read length. It's not linear and is run/library-dependent. It has less to do with exhaustion of reagents and more to do with the strands on a spot being out of phase due to incomplete/missed base incorporation during sequencing. It is common practice to trim off the low quality 3' ends as the ...


1

Well, I'm sure you can find a more efficient approach, but here's a simplistic solution using standard UNIX tools: zcat file.fastq.gz | grep CGC | awk -F'CGC' 'NR%4==2{a[NF-1]++}END{for(i in a){print i,a[i]}}' | sort -rnk2 I tested this on a 2.6G fastq file (exome data) and it took: real 1m18.987s user 1m41.392s sys 0m10.684s ...


Only top voted, non community-wiki answers of a minimum length are eligible