Skip to main content
9 votes

Why does cutadapt remove low quality bases from the ends of reads only?

If you check the read QC statistics of an Illumina run in e.g. fastQC, you will see that at the end of the read the quality decreases. This is because of exhaustion of chemicals at the end of the run. ...
benn's user avatar
  • 3,591
8 votes
Accepted

Why don't all reads have adaptors?

Things like this might depend on your specific library prep, but in general: sequencing starts at the end of the adapter, not before it. You will only see adapters if you sequence through the entire ...
Wouter De Coster's user avatar
7 votes
Accepted

Why does cutadapt remove low quality bases from the ends of reads only?

I am commenting on this part: The algorithm only removes low quality bases from the end until it reaches a good quality base. If there is a bad quality base beyond that, it is not trimmed. ...
user172818's user avatar
  • 6,545
5 votes

removing nextera transposase adapters, cutadapt

The adapter sequence you have googled is the sequence on the adapter primer. This works when you want to remove primer-dimers. With transposase adapters or ATAC seq, you have very short fragments and ...
StupidWolf's user avatar
  • 1,688
3 votes
Accepted

Does cutadapt trim trailing N's first and then use max_n to filter reads?

Yes, it behaves just like you expect, where a read with >40% Ns but only at the ends will still be kept (after trimming). Cutadapt runs in two stages, with read modification first and read ...
Jesse's user avatar
  • 947
3 votes

removing nextera transposase adapters, cutadapt

I cannot quite help(*) on the problem you are having with cutadapt but can point you out to Trimmomatic, for which the ...
haci's user avatar
  • 4,162
2 votes

processing multiple fastq files with cutadapt

Try this one for file in /dir/* do cutadapt -g ACTTAAGTGTATGTAAACTTCCGACTTCAACTG "$file" >> results.out done Also you have omitted ...
prab4th's user avatar
  • 123
2 votes

removing nextera transposase adapters, cutadapt

I came across the same problem of Nextera transposase contamination in my shotgun metagenome sequence. I specified the library in trimmomatic and Nextera transposase adapters were successfully removed....
Yike Shen's user avatar
2 votes

How to identify index sequences for cutadapt for atac-seq

The sequence to trim for ATAC-seq is CTGTCTCTTATACACATCT. It's the Nextera adapter sequence. The sequence is the reverse complement of the 3' ends of your primers, ...
ATpoint's user avatar
  • 1,430
1 vote
Accepted

Error after trimming illumina adapters

First of all, you aren't actually setting the $outfile variable. Your loop has this basic format: ...
terdon's user avatar
  • 10.2k
1 vote

Why does cutadapt remove low quality bases from the ends of reads only?

For Illumina (and 454) reads, the quality decreases with read length. It's not linear and is run/library-dependent. It has less to do with exhaustion of reagents and more to do with the strands on a ...
Edward Kirton's user avatar
1 vote
Accepted

efficient counting of dinucleotides/trinucleotides on fastq reads?

Well, I'm sure you can find a more efficient approach, but here's a simplistic solution using standard UNIX tools: ...
terdon's user avatar
  • 10.2k

Only top scored, non community-wiki answers of a minimum length are eligible