17 votes
Accepted

Publicly available genome sequence database for viruses?

There area few different influenza virus database resources: The Influenza Research Database (IRD) (a.k.a FluDB - based upon URL) A NIAID Bioinformatics Resource Center or BRC which highly curates ...
user avatar
12 votes
Accepted

How do PCR duplicates arise and why is it important to remove them for NGS analysis?

In any scenario where depth of coverage is an important factor, PCR duplicates erroneously inflate the coverage and, if not removed, can give the illusion of high confidence when it is not really ...
user avatar
11 votes
Accepted

Tools for simulating Oxford Nanopore reads

Simulators designed specifically for Oxford Nanopore: NanoSim NanoSim-H SiLiCO ReadSim DeepSimulator General long read simulators: Loresim Loresim 2 FASTQsim LongISLND For an exhaustive list of ...
user avatar
11 votes

Downloading a reference Genome for Bowtie2

It’s a matter of preference I guess but I recommend the Ensembl builds. Decide whether you want the toplevel or primary assembly, and whether you want soft-masked, repeat-masked or unmasked files. The ...
user avatar
9 votes
Accepted

Downloading a reference Genome for Bowtie2

tl;dr: Just use the either the downloads on the Bowtie2 homepage or the Illumina iGenomes. Or just uncompress and concatenate the FASTA files found on UCSC goldenpath and then build the index. A bit ...
user avatar
  • 588
9 votes

Tools for simulating Oxford Nanopore reads

By chance, just today I've heard of a nanopore read simulator, NanoSim. It is released under a GPL license. I have never used it, though...
user avatar
7 votes

Tools for simulating Oxford Nanopore reads

In addition to the already mentioned NanoSim, there is also SiLiCO and ReadSim (although it hasn't been updated in over 2 years, so I am not sure how relevant it is at this point considering how fast ...
user avatar
  • 2,099
7 votes

How do PCR duplicates arise and why is it important to remove them for NGS analysis?

PCR polymerases introduce errors. When an error arises in the first few cycles of amplifications, it will appear in a reasonably high fraction of DNA fragments in the library. After sequencing, you ...
user avatar
  • 5,645
7 votes

What are the pros and cons of the different basecallers in Oxford Nanopore Technology Sequencing?

There are also third party free and open source basecallers that haven't been developed by Oxford Nanopore. Of particular note is Chiron, which gave the best uncorrected assembly identity among the ...
user avatar
  • 11.5k
5 votes
Accepted

What are 2D reads in the Oxford MinIon?

Early MinION sequencing runs had forward and reverse DNA templates joined together by a hairpin adapter, so that the sequencer would read both strands from the same template. The consensus sequence ...
user avatar
  • 11.5k
5 votes

What are the pros and cons of the different basecallers in Oxford Nanopore Technology Sequencing?

It's worth noting two things as of Dec 2018: Albacore is being deprecated (but is still available from the Nanopore developer portal). Guppy is under active development, so Ryan Wick's comparisons ...
user avatar
5 votes
Accepted

What are the pros and cons of the different basecallers in Oxford Nanopore Technology Sequencing?

First of all - yes, you can generate FAST5 files and basecall later. Basecalling during the sequencing run is useful if you want results more quickly. You can also recall your FAST5 files with ...
user avatar
  • 525
4 votes

Publicly available genome sequence database for viruses?

In addition to what others have suggested, I would also recommend PaVE as a resource. This is a curated database maintained by the NIAID and current holds over 300 papilloma virus genomes.
user avatar
  • 255
4 votes

Overlap in Paired-end Reads for Sequencing?

Yes, if the insert size is smaller than the read sizes, this would happen. For some applications, for example SNP detection for molecular diagnostics purposes, this approach is used.
user avatar
  • 3,462
4 votes
Accepted

Separation of mixed plasmid DNA sequences post whole-plasmid sequencing

You would expect to have high coverage, given the plasmids are short, so de novo assembly would be likely very easy. Given that each plasmid is present in different multiples, you would expect ...
user avatar
4 votes

Extract reads from bam files by their @RG

Typically I use samtools for operations like this. Specifically I use samtools view with either -r or ...
user avatar
  • 2,566
4 votes
Accepted

Genome assembly of SRR12196449 with SPAdes

Update 2: I looked into this a little more, with the various data sources. This is related in part to the answer submitted by OP juanjo75es, in addition to discussion on chat. I don't entirely ...
user avatar
3 votes

Produce a single sequential FASTA sequence out of BAM

If you just want the human chromosomes in a FASTA format, why not downloading directly the individual chromosome files (chr*.fa.gz)? If you don't rely on the "...
user avatar
  • 2,614
3 votes
Accepted

Can I run STAR without an annotation file?

I don't think you can use the --quantMode GeneCounts option with no annotations. I think the error is trying to look for an exon file generated from the annotations ...
user avatar
3 votes

Tools for simulating Oxford Nanopore reads

The best nanopore read simulators would be associated with the best base-callers. For a base-caller to effectively model the DNA strand, it needs to take into account the expected underlying ...
user avatar
  • 11.5k
3 votes

Assembly reads having a copy of their beginning in their tail

If you google AGTATGTACAAATACCTACAACTTGTGCT you'll find it's a primer sequence: https://artic.network/resources/ncov/ncov-amplicon-v3.pdf
user avatar
3 votes
Accepted

Length of Contigs in Transcriptome and Whole Genome Assembly

The longest possible transcriptome contig reflects the longest possible transcript. In the human genome, that's possibly Titin, which is ~35K aa (that's ~105Kb) and will be longer pre-splicing. The ...
user avatar
  • 3,462
2 votes

Publicly available genome sequence database for viruses?

Influenza virus resource at NCBI or FluDB.
user avatar
  • 59
2 votes
Accepted

Can the canu assembler output a fastq file of the final assembly just like HGAP4?

I've created an issue on the Canu github repository for this. I'm not aware of any existing functionality to output FASTQ files, but think that this would be a useful feature to have. It would be ...
user avatar
  • 11.5k
2 votes
Accepted

Produce a single sequential FASTA sequence out of BAM

What I wanted to do is called "Consensus Sequence". Two steps were needed: ...
user avatar
2 votes

Separation of mixed plasmid DNA sequences post whole-plasmid sequencing

Let's take a step back and consider the "perfect" output for a de novo assembly algorithm. Ideally, you would like to see one complete sequence for molecule (chromosome, plasmid, etc.). In reality, ...
user avatar
2 votes

Genotyping with Illumina HumanOmni1-Quad before whole genome sequencing

The Illumina HumanOmni1-Quad beadchip is a microarray device consisting of 1,140,419 markers which have derived from the 1,000 genomes project. The markers chosen are is high-value regions of the ...
user avatar
  • 1,119
2 votes

Extract reads from bam files by their @RG

This sounds more like a job for samtools split if you want to split out all the read groups into separate bams in one go. http://www.htslib.org/doc/samtools-split....
user avatar
2 votes

Location of Reads in Sequencing

Mates in a pair are giving signal for a single strand, though this is only apparent in bisulfite-treated samples. The reason for this is that you are sequencing the ends of fragments of material and ...
user avatar
  • 19.3k
2 votes

Genome assembly of SRR12196449 with SPAdes

After many considerations, I am going to accept the response from Maximilian Press. I see now that some viruses have high variability (HIV even 50% of the sequence). Therefore MN630242.1. and U11820.1 ...
user avatar

Only top scored, non community-wiki answers of a minimum length are eligible