Skip to main content
2 votes

Make ipyrad use cuda-enabled NVidia card on Ubuntu

You would have to get CUDA Python set up on your system and likely modify ipyrad to actually use it (for example, by incorporating numba). So while this is possible, it will require significant effort ...
Devon Ryan's user avatar
  • 19.7k
1 vote
Accepted

Confidence intervals around Q-matrix values from multiple STRUCTURE runs

If we consult the structure docs, we observe that they directly address the idea of a $Q$ distribution for each individual (p. 24), in the form of a Bayesian credible interval, which can be obtained ...
Maximilian Press's user avatar
1 vote

Approaches for filtering bacterial/fungal contaminant sequences from RADseq results

I ultimately addressed this issue using the kraken2 software. I found this approach to rely on a good deal of my server's memory, but it was sufficient for doing a viral/bacterial classification of ...
akoontz11's user avatar
  • 123
1 vote

Denovo, Stacks: Getting an “ambiguous redirect” error

This most likely means your variable $logfile does not exist.
Pallie's user avatar
  • 706
1 vote

Why do reverse radtags have different start points in radtag sequencing?

Assume that after digestion you're left with the following sequence: 5' AGCTAGCTAGCTAGCTGACGTCGTAC 3' 3' GTACGACGTCAGCTAGCTAGCTAGCT 5' Then one read would start ...
Devon Ryan's user avatar
  • 19.7k

Only top scored, non community-wiki answers of a minimum length are eligible