Questions tagged [sequence-analysis]

Umbrella term for understanding any given nucleic acid sequence code, either as a locus, loci or genome with itself or as a comparison to comparable nucleic acid sequence code either intraspecifically or interspecifically

Filter by
Sorted by
Tagged with
1 vote
1 answer
35 views

Maximum likelihood estimation for tree construction

Could someone direct me to a resource (textbook chapter, lecture notes, online video, etc.) that demonstrates, in a mathematically or computationally rigorous way, how to use maximum likelihood ...
-1 votes
0 answers
29 views

I am try to do a paired end mapping this is the error :No filename supplied! Please specify one or more files for single-end Bismark mapping! [closed]

/mnt/ext4TB/didem/installations/bismark/Bismark-0.19.1/bismark --genome /mnt/ext4TB/didem/tomato_ref/ -1 /mnt/ext4TB/didem/samples/20191205.B-2744XJ_3_1.trim.fastq.gz -2 /mnt/ext4TB/didem/samples/...
  • 7
-2 votes
0 answers
44 views

Which parameters can be altered in trimmomatic to alter adapter trimming? [closed]

Cross post on Biostars Which parameters can be altered in trimmomatic to alter adapter trimming? I have samples that are run via default mode but I need to change the trimming in a way that would ...
  • 7
1 vote
0 answers
21 views

Could someone help me understand if all sample within this are control group?

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE117872 I'm teaching myself sequence analysis. This is the count data: and then this is, what I believe to be, the coldata: All I want to know is ...
  • 41
0 votes
3 answers
64 views

Analysis of 4665 proteins in String database

Background I have a data set of 4665 proteins from Phytophthora cactorum and want to analyze them in the String database as other database does not have Phytophthora cactorum for GO or KEGG analysis. ...
  • 1
1 vote
1 answer
50 views

What are the columns in bedtools coverage output hist file?

I am using bedtools to caculate the coverage of my targets of my WES data, to later plot. But to plot, I need to know what to plot and what it is I am seeing. I have unsuccefully tried to find what ...
  • 87
1 vote
2 answers
52 views

Summing up data effectively in excel

I have some tsRNA count data in excel which I need to add selectively in blocks based on the count ...
2 votes
1 answer
40 views

need bam file for pilon

I just ran an assembly on yeast genomes using Flye and I want to polish those assemblies with Pilon but it requires a sorted BAM file. How do I make a BAM file of the resulting assembled.fasta?
  • 267
1 vote
0 answers
58 views

Simple template for calculating Shannon diversity index from FASTQ files with R

I have a bunch of files in FASTQ format and need to calculate the Shannon diversity index from all of them. Is there a simple way to do that with R, some kind of step-by-step recipe? My problem is not ...
  • 111
1 vote
1 answer
127 views

reverse translation from amino acid string to DNA strings

what is the opposite of .translate() function calls ? I mean let's say I am given an amino acid string CYCLIC, how do I obtain all the possible combinations of DNA ...
  • 143
0 votes
0 answers
11 views

Comparing loci across catalogs

Context: I'm using the Stacks (v2.59) ref_map.pl command to analyze garden and wild samples of a plant species, and have aligned my paired-end RAD reads to a reference genome (using GSNAP). The goal ...
2 votes
1 answer
229 views

What is the different between the I-TASSER, phyre2, SWISS-model in the 3D tertiary structure?

What is the difference between the I-TASSER, phyre2, and SWISS-model in the 3D tertiary structure? How do they get the results? When I did a prediction, I got a similar result for the highest template ...
0 votes
0 answers
51 views

Locate the saved template of minknow

I am using minknow on ubuntu. After saving the template (settings), where is that file locally stored in the system? Also what is its format/extension?
2 votes
1 answer
109 views

Samtools sort: most efficient approach to sort a single sample after aligning split .fastq files

Related to my other question (Samtools sort: most efficient memory and thread settings for many samples on a cluster), we need to optimize samtools sort as we ...
  • 1,264
2 votes
2 answers
763 views

Samtools sort: most efficient memory and thread settings for many samples on a cluster

We're preparing to analyze thousands of .bam files beginning with re-alignment, sorting, etc. Complicated question: Has anyone investigated the optimal thread and ...
  • 1,264
2 votes
1 answer
231 views

How to run MD5 check for multiple fastq files in different subdirectories?

I have received Illumina sequencing reads for 100 samples. I have 8 R1.fastq.gz and 8 R2.fastq.gz files for each sample in each ...
1 vote
1 answer
38 views

How to rescale a function?

When we have a function which takes values ​​in [a,b] and which returns values ​​in [c,d], what transformation can we do so that the function takes values ​​in [0,1] and returns values ​​in [0,1] ...
1 vote
1 answer
328 views

tensorflow nn_model for DNA sequences: Matrix size-incompatible: In[0]: [2,1], In[1]: [784,300]

Hope anyone can help a beginner here. I'm building a proof-of concept tensorflow classifier for DNA sequences. However, the NN model does not let through train and test vectors saying the matrix size ...
  • 11
0 votes
1 answer
53 views

How to improve a genome assembly using Dovetail and PacBio assembly?

I have more of a conceptual question. I have two genome assemblies from the same plant, one from Dovetail technology (~998 Gb) and another is PacBio HiFi assembly (~1.1 Gb). The Dovetail assembly is ...
1 vote
2 answers
132 views

Help with MinION sequencing data species identification

Hi I'm new to bioinformatics and have just completed my first run on the MinION (long read sequencing Oxford Nanopore Technologies). I was hoping someone could direct me towards R packages, workflow, ...
  • 13
1 vote
1 answer
227 views

Why does randomized motif search work?

I'm looking for intuition for why a randomized motif search works. My current thinking is as follows: We are selecting many random kmers from our DNA sequences. The chosen kmers will bias the profile ...
  • 127
1 vote
1 answer
32 views

How should I downsample and normalize R1s and R2s and incorporate this into Lexogen's QSPA tool

I am using Lexogen's Quantitative Sequencing Pool Analysis tool (here: https://github.com/Lexogen-Tools/quantseqpool_analysis) to analyze R1 and R2 files. I have been able to successfully run this ...
2 votes
1 answer
42 views

How to map list items which are in groups in the dictionary values and return keys corrosponding it?

...
1 vote
0 answers
52 views

Downloading exon-wise gene sequence using commandline

I want to download exon-wise gene sequence of around 200 genes from NCBI. Is there anyway to do this from terminal? I have the transcript id for each sequence and I am using efetch command to download ...
2 votes
0 answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
  • 145
-1 votes
1 answer
153 views

How to get a FASTA format file with the DNA sequences of all annotated genes?

I am analysing Pyrococcus Furiosus DNA sequencing data by considering data published here in NCBI. When I click on "Send to">"Gene Features">"FASTA format" I ...
0 votes
1 answer
123 views

How to Read SCF file in Python?

Is there any way that I can read SCF file in python like in R using sangerseqR, I have tried with Biopython, it seems it does not support this format.
  • 151
0 votes
0 answers
54 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
  • 320
1 vote
1 answer
56 views

Where to find publicly available Sanger chromatography data?

I am looking for any public available databases where I can download Sanger chromatography data ideally in Ab1 or SCF file format. I need extremely large amounts of this, since I want to use it for ...
  • 151
0 votes
1 answer
104 views

calculating kmer nucleotide frequency per column

I have a list of sequences: CAGGTAGCC CCGGTCAGA AGGGTTTGA TTGGTGAGG CAAGTATGA ACTGTATGC CTGGTAACC Each sequence is nine nucleotides long. I want to calculate ...
0 votes
2 answers
110 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
0 votes
1 answer
540 views

Converting Fastq files to Fasta files on Ubuntu

I am new to bioinformatics and programming. I tried to convert my fastq files to fasta file, but got this. What could be wrong? ...
3 votes
2 answers
47 views

Retrieval of metadata of a batch of 3953 sequence data from GISAID database

I need to retrieve COVID-19 metadata (such as date of collection of sequence data, location, etc.) for a batch of 3953 GISAID accessions from the GISAID database. I am not very comfortable with GISAID....
2 votes
1 answer
41 views

How to deal with wildcards (N) in sequence logos

This is an open question that came to my mind recently, though it might be that it is not a common use case. The purpose is to find common patterns in a collection of sequences by representing the ...
  • 143
1 vote
2 answers
350 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
0 votes
1 answer
59 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
  • 1,417
2 votes
2 answers
177 views

Get frequency of index sequences of fastq file

I recently did some sequencing on a MiniSeq and unexpectedly the Undetermined_S0_L001_R1_001.fastq.gz file contained quite a lot of data (about 40% of total). I ...
-2 votes
1 answer
67 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
0 votes
1 answer
241 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
1 vote
2 answers
50 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
  • 149
1 vote
1 answer
115 views

Interpreting contig alignments to a reference genome

I have applied two de novo genome assembly tools to data from the run SRR12707453, corresponding to a phage (I downloaded the data and have no relation with the authors of the study). Using rnaSPAdes ...
1 vote
2 answers
170 views

Are codons in RNA layered? Are we misinterpreting RNA codons?

I am analyzing nucleotide base-pair patterns in RNA and DNA, and had a thought about RNA and DNA (Let me first state though, I am not a biologist; I am an algorithmatician, employing a sort of ...
0 votes
3 answers
593 views

Finding motifs: fasta file with 10,000 sequences

I am new to Python. I am trying to parse a fasta file containing 10,000 sequences to look for motifs (microsatellites in particular). I tried using Seq Utils to parse my sequences for a particular ...
  • 31
2 votes
1 answer
37 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
1 vote
1 answer
86 views

How to understand methylation level?

For Bisulfite Sequencing data, we can calculate methylation level for a specific locus, $$ \mbox{methylation level} = \frac{\mbox{# methelyated reads}}{\mbox{# total reads}} $$ Here I think, for this ...
  • 113
1 vote
0 answers
66 views

How to implement SEG (Wootton and Federhen ,1993) algorithm?

I want to implement SEG in my MATLAB environment and I'm relying on Wootton and Federhen (1993) Reading the article I cannot succeed to understand what kind of process I have to implement in order to ...
0 votes
2 answers
41 views

Separating peaks of chip-seq with specific length

My data contain several chip-seq results. I have the peaks called by MACS2.I wanted to only look at those peaks that their size is e.g 500bp to 1000bp. How can I separate those peaks efficiently? I ...
  • 95
2 votes
1 answer
32 views

How to calculate the number of peaks that are upstream/downstream of some other peaks

I have 3 histone marks,I have used Macs2 for peak calling and diffBind to analyze the peaks. I was wondering if you know any way to calculate the peak numbers of one specific histone mark that occur ...
  • 95
1 vote
1 answer
45 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
  • 95
4 votes
2 answers
6k views

Calculating average coverage for .bam files (sequence data)

(Full discolosure that this is my first time working with sequence data, and with the bash scripting.) I need to calculate the average coverage for any .bam file. After some searching I wrote the ...
  • 143