Skip to main content
Liam McIntyre's user avatar
Liam McIntyre's user avatar
Liam McIntyre's user avatar
Liam McIntyre
  • Member for 4 years, 3 months
  • Last seen more than 1 year ago
1 vote

How to compare sequences of genes obtained after whole-genome sequencing to reference genome?

1 vote

Retrieval of metadata of a batch of 3953 sequence data from GISAID database

0 votes

Calculate genome coverage and depth from alignment

2 votes
Accepted

Converting FASTA Sequences to SNP FASTA Format

1 vote

Print specific columns in a matrix on the basis of sample id's in the header

3 votes
Accepted

KeyError when getting features from a genbank file with biopython with some accessions but not others

1 vote

extract chimeric and multimap reads from bam file

2 votes
Accepted

How can I run the latest version of samtools on Slurm?

1 vote

How can I use my Myheritage DNA results file for further analysis?

2 votes
Accepted

Obtaining Whole Genetic Sequence

1 vote
Accepted

Supplementary aligments in VAF

1 vote

blast p-error with making directory

1 vote

How to remove sequences from a fasta file using a sequence ID list which contains a space within the id?

3 votes
Accepted

How to filter out partially similar strings from two lists and make one list?

1 vote

What are the applications of DNA or RNA pattern matching?

1 vote

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC

0 votes

Genome QC + Assembly Pipeline semantics

1 vote

What tools can I use to look up my alleles, genotypes, or phenotypes from my sequenced DNA (WGS)?

1 vote

Splitting a GenBank file into smaller files

1 vote

Sequence alignment using BWT

0 votes

How to remove duplicates from a fasta file using python

1 vote

Find pattern that is present twice and allow <=2 mismatches on each

2 votes
Accepted

What changed wwith Python in WDL change from draft 2 to version 1?