6
$\begingroup$

I have few BAM files which are generated from Ion Torrent Server (ampliseq) aligned to hg19 genome. I want to extract read counts from the bam files and I know that "featureCounts" can be used for this. But before getting the read counts, to view the bam file I gave the following command:

samtools view -H IonXpress_input.bam

Output:

@HD VN:1.4  SO:coordinate   GO:none
@SQ SN:NR_039978    LN:984
@SQ SN:NM_130786    LN:1766
@SQ SN:NM_138932    LN:9293
@SQ SN:NM_033110    LN:2678
@SQ SN:NM_000014    LN:4678
@SQ SN:NM_144670    LN:5192
@SQ SN:NR_040112    LN:1201
@SQ SN:NM_017436    LN:2106
@SQ SN:NM_016161    LN:1771
@SQ SN:NM_015665    LN:1854

I guess these are from header. After these I see something like following:

@RG ID:JODXM.IonXpress_022.1    CN:S5TorrentServerVM/MT205524   DT:2017-12-07T12:04:52+0100 FO:TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGA KS:TCAGTTCGAGACGCGAT    PG:tmap PL:IONTORRENT   PU:s5/540/IonXpress_022 SM:SNU449_TEAD4

Haven't seen a bam file like this before. Any idea what are these and how I can get read counts?

Improve this question
$\endgroup$

1 Answer 1

Reset to default
7
$\begingroup$

Your data is not aligned to hg19, but to a bunch of RNA ref sequences. If you would align to hg19 you'll get each chromosome instead of the NR_* or NM_* accession codes with your samtools view -H code. With samtools idxstats file.bam you'll get the reads per chromosome (or per nucleotide sequence in your case).

For use in featureCounts my advice is to get the fastq files, and align it yourself to hg19 (or hg38 to be more up to date).

If your data is properly aligned to hg19 your output should be something like this:

samtools view -H aligned2hg19.bam

@SQ SN:chrM LN:16571
@SQ SN:chr1 LN:249250621
@SQ SN:chr2 LN:243199373
@SQ SN:chr3 LN:198022430
@SQ SN:chr4 LN:191154276
@SQ SN:chr5 LN:180915260
@SQ SN:chr6 LN:171115067
@SQ SN:chr7 LN:159138663
@SQ SN:chr8 LN:146364022
@SQ SN:chr9 LN:141213431
@SQ SN:chr10    LN:135534747
@SQ SN:chr11    LN:135006516
@SQ SN:chr12    LN:133851895
@SQ SN:chr13    LN:115169878
@SQ SN:chr14    LN:107349540
@SQ SN:chr15    LN:102531392
@SQ SN:chr16    LN:90354753
@SQ SN:chr17    LN:81195210
@SQ SN:chr18    LN:78077248
@SQ SN:chr19    LN:59128983
@SQ SN:chr20    LN:63025520
@SQ SN:chr21    LN:48129895
@SQ SN:chr22    LN:51304566
@SQ SN:chrX LN:155270560
@SQ SN:chrY LN:59373566
Improve this answer
$\endgroup$
14
  • $\begingroup$ So, I confirmed with the people who gave me these bam files. These are aligned to hg19 genome only. $\endgroup$
    – stack_learner
    Commented Dec 14, 2017 at 10:39
  • $\begingroup$ Please show your output to these people. $\endgroup$
    – benn
    Commented Dec 14, 2017 at 10:42
  • $\begingroup$ But you mean the bam file I have doesn't have any chr, read count and other details? I was thinking the above posted one are from header and there is another command to get the readcounts and other details. $\endgroup$
    – stack_learner
    Commented Dec 14, 2017 at 10:46
  • 4
    $\begingroup$ Maybe you misunderstood, but you need to correctly align to hg19 first in order to do this in featureCounts. From your output it is clear that it is not aligned to hg19, but to a bunch of RNA sequences. Please discuss with your people that your data is not properly aligned to hg19 (show your output, this is proof), or try to align it yourself from fastq. When you have done that, you'll need a proper gtf annotation file from UCSC or ENSEMBL which is necessary for featureCounts. Good luck! $\endgroup$
    – benn
    Commented Dec 14, 2017 at 11:05
  • 3
    $\begingroup$ When you are told they are aligned to hg19, I guess they mean tat are aligned to the hg19 version of the transcriptome, not hg19 itself. In this case you done need featureCounts to get read counts (and indeed, it would be hard/impossible to do so). samtools idxstats should give you want you are looking for. $\endgroup$
    – Ian Sudbery
    Commented Dec 14, 2017 at 12:53

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Not the answer you're looking for? Browse other questions tagged or ask your own question.