1
$\begingroup$

I have a following fasta (produced by stacks populations):

>CLocus_10056_Sample_934_Locus_12529_Allele_0 [sample_934; groupI, 49712]
TGCAGGCCCCAGGCCACGCCGTCTGCGGCAGCGCTGGAAGGAGGCGGTGGAGGAGGCGGCCAACGGCTCCCTGCCCCAGAAGGCCGAGTTCACCG
>CLocus_10056_Sample_934_Locus_12529_Allele_1 [sample_934; groupI, 49712]
TGCAGGCCCCAGGCCACGCCGTCTGCGGCAGCGTTGGAAGGAGGCGGTGGAGGAGGCGGCCAACGGCTCCCTGCCCCAGAAGGCCGAGTTCACCG

as both alleles are represented separetely, I want to combine both genes using IUPAC nucleotide code. Is there a tool for it or is it more useful to do it via a custom script?

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.