1
$\begingroup$

I have a following fasta (produced by stacks populations):

>CLocus_10056_Sample_934_Locus_12529_Allele_0 [sample_934; groupI, 49712]
TGCAGGCCCCAGGCCACGCCGTCTGCGGCAGCGCTGGAAGGAGGCGGTGGAGGAGGCGGCCAACGGCTCCCTGCCCCAGAAGGCCGAGTTCACCG
>CLocus_10056_Sample_934_Locus_12529_Allele_1 [sample_934; groupI, 49712]
TGCAGGCCCCAGGCCACGCCGTCTGCGGCAGCGTTGGAAGGAGGCGGTGGAGGAGGCGGCCAACGGCTCCCTGCCCCAGAAGGCCGAGTTCACCG

as both alleles are represented separetely, I want to combine both genes using IUPAC nucleotide code. Is there a tool for it or is it more useful to do it via a custom script?

Improve this question
$\endgroup$

0

Reset to default

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Browse other questions tagged or ask your own question.