2
$\begingroup$

I have into a dictionary some sequences. I would like to replace the sequences name for new names contained into a dataframe.

#my sequences into a dictionary
sequence = {"seq01": "agatcatggctaactatgcacgtgca",             
           "seq02": "atatcatggctaactatgcacgtgca",
           "seq03": "tgatcatggctaactatgcacgtgca"}

#my data frame containing old names and new names
data = {"old_name": ["seq01", "seq02","seq03"], "new_name": ["sample1", "sample2", "sample3"]}
data = pd.DataFrame(data)
print(data)

I tried to replace the old names with a for loop, but it was imposible to do it.

Thank you

Improve this question
$\endgroup$

1 Answer 1

Reset to default
4
$\begingroup$

I am pretty sure there would be more elegant, in-place solutions but here is a quick solution to your problem. Should be OK if your sequence dictionary is not way too large.

seq_names = zip(data['old_name'], data['new_name']) # brings together old and new names in tuples
renamed_sequence = {}
for i in seq_names:
    renamed_sequence[i[1]] = sequence[i[0]]
renamed_sequence

EDIT: The section below is not quite accurate, please see the comments below.

And regarding your comment:

I tried to replace the old names with a for loop, but it was imposible to do it.

You are not supposed to loop over and at the same time modify an element at the same time anyway (there might be side effects that you would not think of), hence a brand new dictionary in my code.

Improve this answer
$\endgroup$
4
  • $\begingroup$ "You are not supposed to loop over and at the same time modify an element at the same time anyway": really? Why? Is that a Python thing? $\endgroup$
    – terdon ♦
    Commented Nov 21, 2021 at 11:28
  • $\begingroup$ @terdon, you are right, I should have been more explicit. For example changing the elements of a list while iterating over it would be fine, on the other hand, adding/removing elements while looping through a list would cause problems. In this particular case, the OP would be modifying the elements of a dictionary rather than changing its size, so an in-place solution using a for loop would be perfectly fine. $\endgroup$
    – haci
    Commented Nov 21, 2021 at 11:42
  • $\begingroup$ Ah, right. Things like entering an infinite loop with something like list.append(foo) running in a for i in list. Gotcha, thanks. $\endgroup$
    – terdon ♦
    Commented Nov 21, 2021 at 11:44
  • 2
    $\begingroup$ I would encourage you to improve your variable naming to something more descriptive: replace i with the tuple (old_name, new_name); names_tuple can become old2new or similar and new_dict could be called renamed. This yields the in my opinion much more readable assignment renamed[new_name] = sequence[old_name] which describes the code's intention. I think this is important because answers here serve as a reference for other coders and we should try to improve the overall quality of scientific software. $\endgroup$
    – Jan Wilamowski
    Commented Nov 22, 2021 at 2:23

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Not the answer you're looking for? Browse other questions tagged or ask your own question.