-3
$\begingroup$

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't right.

$\endgroup$
2
  • 1
    $\begingroup$ So you googled what fasta format looks like for DNA, and you concluded from what you read that it meant to translate the DNA into protein? $\endgroup$
    – swbarnes2
    Feb 3 at 18:18
  • $\begingroup$ FASTA is a sequence format, and it is used for any sequence, including DNA and protein sequence. Translating DNA to protein sequence does not require FASTA or any format, for that matter - the sequence itself is enough. Please clarify your question. $\endgroup$ Feb 3 at 19:25
1
$\begingroup$

This is your nuc seq as a fasta:

>sequence_1
TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC

To translate it use an online tool (ie https://web.expasy.org/translate/) or do it in biopython:

from Bio import SeqIO
for record in SeqIO.parse("/path/seq1.fa", "fasta"):
    print ('nuc', record, sep='\n')
    print ('prot', record.translate(), sep='\n')

Which gives:

nuc
ID: sequence_1
Name: sequence_1
Description: sequence_1
Number of features: 0
Seq('TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC', SingleLetterAlphabet())
prot
ID: <unknown id>
Name: <unknown name>
Description: <unknown description>
Number of features: 0
Seq('LKHWMNEKPCFATPQ', ExtendedIUPACProtein())

Note, this defaults to the human codon table. Other codon tables are available with the parameter 'table'.

$\endgroup$

Not the answer you're looking for? Browse other questions tagged or ask your own question.