TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't right.
2
-
1$\begingroup$ So you googled what fasta format looks like for DNA, and you concluded from what you read that it meant to translate the DNA into protein? $\endgroup$– swbarnes2Commented Feb 3, 2021 at 18:18
-
$\begingroup$ FASTA is a sequence format, and it is used for any sequence, including DNA and protein sequence. Translating DNA to protein sequence does not require FASTA or any format, for that matter - the sequence itself is enough. Please clarify your question. $\endgroup$– Timur ShtatlandCommented Feb 3, 2021 at 19:25
Add a comment
|
1 Answer
$\begingroup$
$\endgroup$
This is your nuc seq as a fasta:
>sequence_1
TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC
To translate it use an online tool (ie https://web.expasy.org/translate/) or do it in biopython:
from Bio import SeqIO
for record in SeqIO.parse("/path/seq1.fa", "fasta"):
print ('nuc', record, sep='\n')
print ('prot', record.translate(), sep='\n')
Which gives:
nuc
ID: sequence_1
Name: sequence_1
Description: sequence_1
Number of features: 0
Seq('TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC', SingleLetterAlphabet())
prot
ID: <unknown id>
Name: <unknown name>
Description: <unknown description>
Number of features: 0
Seq('LKHWMNEKPCFATPQ', ExtendedIUPACProtein())
Note, this defaults to the human codon table. Other codon tables are available with the parameter 'table'.
