2
$\begingroup$

I am analyzing some SARS-CoV-2 sequencing runs abd often find read alignments like the one in the image.enter image description here

GACCCGGTGGGTTTTAC---ACTTAAAAACACAGTCTGTAC
GACCCTGTGGGTTTTAC---ACTTAAAAACACAGTCTGTAC
          GTTTCAC---ACTTAAAAACACAGTCTGTAC
          GGTTTAC---ACTTAAAAGCACAGTCTGTAC
CCACACTCTCCTAGCAC---ACTTAAAAACACAGTCTGTAC
CCACACTCTCCTAGCACCATACTTAAAAACACAGTCTGTAC

It basically says there are reads that share part of a sequence and part of another one. The first 4 reads are the same sequence and it's a sequence that you can effectively find in the official SARS-CoV-2 assembly but the other two reads are a mix of this one with another sequence (and both are the same mix) but with only a small (3bps) indel of difference.

The sequence of the last two reads does not appear anywhere in the official SARS-CoV-2 sequence.

  • What does it mean?
  • Are these sequencing errors?
  • If that is the case how is it that the same mistake is repeated with similar but not exactly the same data?
  • If these are real RNA sequences present in the probe, why are these not used anywhere in the final assembly and how did they arrive there?

Is there any other option that I am missing?

Improve this question
$\endgroup$
2
  • $\begingroup$ That's an old question that somehow has reappeared today. I'd like to point out that I realized months later that there was a problem in my alignment software and I think that's why there was a repeated indel. $\endgroup$
    – juanjo75es
    Commented Nov 14, 2020 at 2:51
  • 1
    $\begingroup$ There is a lot of biological interest in this sort of question, so its really important to understand this thoroughly $\endgroup$
    – M__ ♦
    Commented Dec 5, 2020 at 10:11

1 Answer 1

Reset to default
2
$\begingroup$

The unaligned parts of the bottom two sequences are from elsewhere in the sars-cov-2 genome if you blast them. Likely causes of this are library prep. artifacts (not terribly common, but you'll find a few cases here in there once you have millions of reads) where fragments end up ligating together or (probably more likely) rearrangements of the viral sequence. My guess would be that the latter is what occurred, given how rapidly viruses reproduce. Whether that arrangement can lead to viable viruses I don't know (that's too far out of my field).

Assemblies represent at best a snapshot of a single example of a species at a single moment in time. Actual individuals in the wild can vary quite substantially, especially when they don't need to be viable.

Improve this answer
$\endgroup$
4
  • $\begingroup$ Thanks Devon. Isn't it curious that there was a rearrangement at this location and next an error in replication at two bp distance? $\endgroup$
    – juanjo75es
    Commented Apr 16, 2020 at 20:51
  • $\begingroup$ Not really, locations with issues tend to be near to another. $\endgroup$
    – Devon Ryan
    Commented Apr 16, 2020 at 20:52
  • $\begingroup$ I have news about that. I have found that sometimes there is a merge between a read and a reverse-complemented read. That can only mean that the merge occurs when the sequence has been translated to DNA in the PCR phase. Therefore at least in some cases it doesn't seem to be a rearrangement of the virus. An example read for SARS-CoV-2: AGGTAATAGCACATCACTACGCAACTTTAGATACATTTCTTTATTTAACAAAAAGGTGCACAGCGCAGCTTCTTCAAAAGTACTAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC $\endgroup$
    – juanjo75es
    Commented Apr 26, 2020 at 1:02
  • $\begingroup$ That happens during library prep whenever the amplified fragment is less than twice the read length. $\endgroup$
    – Devon Ryan
    Commented Apr 26, 2020 at 7:02

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Not the answer you're looking for? Browse other questions tagged or ask your own question.