Questions tagged [dna]

Acronym for deoxyribonucleic acid, the unit of inheritance for all eukaryotic and prokaryotic organisms

Filter by
Sorted by
Tagged with
0 votes
0 answers
42 views

What is the best tools to find all the somatic mutations?

I am a beginner in this field. I would like to know which is the best way to get all the mutations from a certain sample. At this point, I am considering using GATK (here) and Maftools (here). I don't ...
user avatar
  • 135
2 votes
1 answer
21 views

Where to get BED files for regions that contain binding site motifs for specific transcription factors?

Quick question, is there a place where one can download BED files for the binding motifs of certain transcription factors. In my case, I'm looking for a BED file for the genomic regions (enhancers) ...
user avatar
0 votes
1 answer
21 views

Independent Subset of Rectangles Problem for Nonoverlapping local alignments

I'd like to implement a graph-based algorithm for DNA comparison, more especially by solving a problem that can be formulated as a Maximum Weighted Independent Set problem. I have found the article in ...
user avatar
  • 109
0 votes
0 answers
17 views

Generating intercalation site in DNA for custom sequence

Thank you for your help. Can anybody please tell me how I can generate an intercalation site in DNA at the base pairs I am interested on. I appreciate if you can please guide me to any tutorials or ...
user avatar
0 votes
1 answer
75 views

Help me in understanding the PDB file

Can anybody please explain the below line to me. "We took the structure and coordinates of nogalamycin from the X-ray structure determined in PDB code = 1D17" What do I need to download from ...
user avatar
2 votes
1 answer
39 views

Simulation of DNA sequences through substitution rates

I'm looking for a little bit of guidance. My question is regarding the simulation of DNA sequences with a fix substitution rate. The majority of the programs for simulating sequences use Continuous ...
user avatar
  • 23
1 vote
1 answer
27 views

building complex drug-dna for AMBER software

I will appreciate if you can please clarify some of my doubts about drug-DNA complex. I want to study the drug-DNA simulation using AMBER. I did go through all the tutorials video on youtube but ...
user avatar
4 votes
1 answer
65 views

Counting hexamers in fasta sequence and identify its structure (and interruptions)

I have a lot of fasta files, each one with thousand of reads containing the hexameric motif "CCCTCT". The hexameric motif is highly continuous in most cases but interruptions may occur. I ...
user avatar
  • 41
0 votes
0 answers
26 views

Drug-DNA complex simulation using AMBER

I want to carry out the simulation of drug-dna complex by placing the drug molecule at particular site in my DNA sequence (intercalating site). I have PDB files of both drug and DNA sequence. I will ...
user avatar
1 vote
2 answers
288 views

Generating PDB file for custom DNA sequence

I asked this question in biology.stack exchange and was referred to this community. I am going to request migration for this question. https://biology.stackexchange.com/q/105024/67415 I want a PDB ...
user avatar
0 votes
0 answers
31 views

getting PDB file of interested sequence

I want a PDB file of DNA sequence I am interested in (10 base pairs) for docking. I will appreciate if any of you can please clarify some of my doubts. Do you think, I can generate PDB file by using ...
user avatar
6 votes
1 answer
83 views

Why does the SARS-Cov2 genome has letter t [duplicate]

ATTAAAGGTT TATACCTTCC CAGGTAACAA ACCAACCAAC TTTCGAT... is part of the 5'UTR of genome of an RNA virus SARS-Cov-2. RNA contains letters ...
user avatar
-1 votes
1 answer
27 views

What is meant by transcriptional changes executed by the cell over a time period?

I read the following line in the research paper - The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells: During differentiation, for example, each ...
user avatar
1 vote
1 answer
64 views

Translate all reads in a .fastq into protein sequence from deep mutational scanning experiment

I'm working with paired-end NGS reads from an Illumina platform. The sequences I have are all of the same gene, but have one or more substitution mutations each. Here is a rough workflow for ...
user avatar
  • 13
1 vote
1 answer
21 views

Encoding different DNAs in pySBOL3?

I want to encode two different DNAs using pySBOL3. First dna is an engineered region usually composed by a transcriptional unit (TU) or a set of TUs. The second is vector which is a basically a ...
user avatar
0 votes
0 answers
48 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
user avatar
  • 320
0 votes
1 answer
47 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
user avatar
1 vote
1 answer
39 views

Output of allelic association doesn't write the rsID

I'm using plink (1.9b5) to do allelic association. My problem is that my output does not write the rsID (SNP), it just writes a dot. Output: ...
user avatar
  • 11
1 vote
2 answers
121 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
user avatar
0 votes
1 answer
53 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
user avatar
  • 1,347
1 vote
0 answers
16 views

How to interpret complete genome sequence in NCBI

I have a very basic and quick question: does the complete sequence of nucleotides of an organism (for example this one that I am considering in my homework of Pyrococcus Fuoriosus) reported in NCBI ...
user avatar
2 votes
2 answers
94 views

What is the file .mums created by mummer?

I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I did are: 1.create a file .mums with the following command line: ...
user avatar
2 votes
1 answer
83 views

Shannon's Entropy and DNA

I have been working with Shannon's entropy (SE) and DNA lately, and referring to the formula and concept of SE, I just wondered whether one should in the case of DNA use each nucleotide as having a ...
user avatar
  • 43
3 votes
1 answer
26 views

Tajima-Nei Distance estimate with BioPerl

I have been trying to estimate Tajima-Nei distance for my data (link below). The output is s phylogenetics distance (pairwise) matrix which accommodates a detailed transition transversion and the ...
user avatar
  • 153
1 vote
2 answers
201 views

Fastq: how can I check if they are from DNA or RNAseq data?

I have (gave me) Illumina fastq files, which I want to use for variant calling, and I do not know if they are DNAseq or RNAseq data. How can I check this? I do not have any report or who to ask. Many ...
user avatar
0 votes
1 answer
30 views

Dataset showing evolution of gene

As a way to exemplify how the hierarchical clustering of particular DNA sequences can be used to derive phylogenetic trees, I'm looking for a (even very small) dataset of the same genes (or other ...
user avatar
  • 149
0 votes
0 answers
181 views

Convert DNA raw data between a different formats [duplicate]

I have .vcf file with partly decoded genome provided by some service. How can I convert this file into other popular formats which may be used in other services? I'...
user avatar
2 votes
1 answer
117 views

How can I use my Myheritage DNA results file for further analysis?

I had my DNA tested by Myheritage and they sent me a csv file with RSID, Chromosome, position and result (which base) with about 700,000 rows. I understand most analyses of DNA use VCF files but is ...
user avatar
-3 votes
1 answer
47 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
user avatar
2 votes
4 answers
265 views

What are the applications of DNA or RNA pattern matching? [closed]

I'm assuming we don't do pattern matching in DNA or RNA for the fun of it. So I'd like to know what are the applications of pattern matching or where does it fit in in larger applications? I'm a ...
user avatar
0 votes
0 answers
53 views

Pairwise alignment using CIGAR String

I want to perform pairwise alignment and get the resulting CIGAR string. The channel can emit insertions, deletions and substitution errors. For example, if the input was AAGCT Then the output could ...
user avatar
0 votes
0 answers
24 views

DNA sequence error annotation

Suppose I generate a DNA sequence of the following pattern. AAGTC And after being passed through a channel with insertion, deletion and substitution errors obtain the following sequence AAAGGC Where ...
user avatar
0 votes
1 answer
152 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
user avatar
1 vote
2 answers
49 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
user avatar
  • 149
1 vote
1 answer
51 views

Get raw genome sequence

I'm currently working on testing some matching algorithms for strings. I would like to do some tests on raw genomic data as I expect different results from random strings given the lower entropy. How ...
user avatar
  • 149
0 votes
1 answer
155 views

Reading fasta sequence regions with faidx

Im coding in c++ and reading in different reference genomes to examine regions across the chromosomes a few hundred basepairs at a time. To do it in c++ i use the library htslib and the command ...
user avatar
2 votes
1 answer
57 views

Mining documents for nucleotide and peptide sequences

The text mining literature has an emphasis on identifying and normalizing gene names, mutations, pathways, concepts, and so on. I haven't been able to find much, however, on methods for extracting ...
user avatar
4 votes
1 answer
121 views

Are there computational tools to extract features of DNA sequences?

I am looking for tools to extract features from short DNA sequences. For example, entropy, complexity, GC-content, etc. I have found the generateFeatures.py script from the PyFeat repo, but is there ...
user avatar
  • 1,347
1 vote
1 answer
30 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
user avatar
0 votes
1 answer
50 views

BioJava - Protein to DNA

Using Biojava 5, I am trying to convert a sequence of Amino Acids to a Nucleotide sequence. Any idea how to do this?
user avatar
6 votes
1 answer
375 views

Biohackers Netflix - DNA to binary and video

I'm not sponsored or anything, just interested in their challenge to decipher their DNA code. They encoded their first episode of "Biohackers" video/binary file to DNA code and said if we ...
user avatar
  • 63
0 votes
0 answers
36 views

Greedy Motif Search [ Reasoning ]

I was able to execute the algorithm correctly. But I'm still trying to get a hold of the result I'm achieving. This is the algorithm I'm trying to understand - http://rosalind.info/problems/ba2d/ If ...
user avatar
  • 101
1 vote
1 answer
164 views

Need a alternative or more complex version of venn diagram in python for matching dna sequences

I am in google colab and I have combined and set up a data frame list of sequences that goes like this Location ID Sequence 1.1 ........ A ........ AAGAGATA 1.2 ........ A........... ...
user avatar
0 votes
2 answers
59 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
user avatar
0 votes
2 answers
51 views

Transcribing DNA exons and append transcripts into a list

I am trying to find a way to read and transcribe a list of DNA sequences (list of lists) only when the for loop finds a start codon (triplet of the list items) and until it finds a stop codon, over ...
user avatar
1 vote
0 answers
38 views

"How the clustal omega can be reverse engineered, to trace ancestral inversion mutations via the guide tree?"

I apologise for very basic question but I am very new to biology and have very specific knowledge of this field, I am currently working on Bioinformatics in my machine learning project which is why I ...
user avatar
1 vote
1 answer
40 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
user avatar
  • 95
0 votes
0 answers
41 views

Coding vs non-coding DNA length

I am trying to calculate the total exonic length (in bp) in order to see where the coding-noncoding ratio of roughly 1% to 99% comes from. We know all chromosomes total about 3 billion base pairs. So ...
user avatar
  • 1
0 votes
0 answers
120 views

Calculate Entropy for DNA Multiple Sequence Alignment in R

I am pretty new to R. So I apologize for asking maybe a very basic question. Let's say I have a fasta file with sequence below: ...
user avatar
0 votes
1 answer
45 views

Encoding a 15bp DNA sequence into a shorter than 15 digits number

I have a series of 15bp DNA sequences from single-cell barcodes and I would like to encode them into a shorter than 15 digits number so that each unique 15bp DNA sequence will create a unique numeric ...
user avatar
  • 2,224