Questions tagged [dna]

Acronym for deoxyribonucleic acid, the unit of inheritance for all eukaryotic and prokaryotic organisms

Filter by
Sorted by
Tagged with
1
vote
1answer
27 views

Output of allelic association doesn't write the rsID

I'm using plink (1.9b5) to do allelic association. My problem is that my output does not write the rsID (SNP), it just writes a dot. Output: ...
1
vote
2answers
54 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
0
votes
1answer
40 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
1
vote
0answers
14 views

How to interpret complete genome sequence in NCBI

I have a very basic and quick question: does the complete sequence of nucleotides of an organism (for example this one that I am considering in my homework of Pyrococcus Fuoriosus) reported in NCBI ...
2
votes
2answers
43 views

What is the file .mums created by mummer?

I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I did are: 1.create a file .mums with the following command line: ...
2
votes
1answer
49 views

Shannon's Entropy and DNA

I have been working with Shannon's entropy (SE) and DNA lately, and referring to the formula and concept of SE, I just wondered whether one should in the case of DNA use each nucleotide as having a ...
2
votes
0answers
17 views

Tajima-Nei Distance estimate with BioPerl

I have been trying to estimate Tajima-Nei distance for my data (link below). I´m following this protocol from BioPerl: https://metacpan.org/pod/Bio::Align::DNAStatistics I have 314 sequences in a ...
1
vote
2answers
106 views

Fastq: how can I check if they are from DNA or RNAseq data?

I have (gave me) Illumina fastq files, which I want to use for variant calling, and I do not know if they are DNAseq or RNAseq data. How can I check this? I do not have any report or who to ask. Many ...
0
votes
1answer
27 views

Dataset showing evolution of gene

As a way to exemplify how the hierarchical clustering of particular DNA sequences can be used to derive phylogenetic trees, I'm looking for a (even very small) dataset of the same genes (or other ...
0
votes
0answers
71 views

Convert DNA raw data between a different formats [duplicate]

I have .vcf file with partly decoded genome provided by some service. How can I convert this file into other popular formats which may be used in other services? I'...
2
votes
1answer
41 views

How can I use my Myheritage DNA results file for further analysis?

I had my DNA tested by Myheritage and they sent me a csv file with RSID, Chromosome, position and result (which base) with about 700,000 rows. I understand most analyses of DNA use VCF files but is ...
-3
votes
1answer
38 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
2
votes
4answers
130 views

What are the applications of DNA or RNA pattern matching? [closed]

I'm assuming we don't do pattern matching in DNA or RNA for the fun of it. So I'd like to know what are the applications of pattern matching or where does it fit in in larger applications? I'm a ...
0
votes
0answers
39 views

Pairwise alignment using CIGAR String

I want to perform pairwise alignment and get the resulting CIGAR string. The channel can emit insertions, deletions and substitution errors. For example, if the input was AAGCT Then the output could ...
0
votes
0answers
23 views

DNA sequence error annotation

Suppose I generate a DNA sequence of the following pattern. AAGTC And after being passed through a channel with insertion, deletion and substitution errors obtain the following sequence AAAGGC Where ...
0
votes
1answer
54 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
1
vote
2answers
40 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
1
vote
1answer
44 views

Get raw genome sequence

I'm currently working on testing some matching algorithms for strings. I would like to do some tests on raw genomic data as I expect different results from random strings given the lower entropy. How ...
0
votes
1answer
91 views

Reading fasta sequence regions with faidx

Im coding in c++ and reading in different reference genomes to examine regions across the chromosomes a few hundred basepairs at a time. To do it in c++ i use the library htslib and the command ...
2
votes
1answer
55 views

Mining documents for nucleotide and peptide sequences

The text mining literature has an emphasis on identifying and normalizing gene names, mutations, pathways, concepts, and so on. I haven't been able to find much, however, on methods for extracting ...
4
votes
1answer
106 views

Are there computational tools to extract features of DNA sequences?

I am looking for tools to extract features from short DNA sequences. For example, entropy, complexity, GC-content, etc. I have found the generateFeatures.py script from the PyFeat repo, but is there ...
1
vote
1answer
19 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
0
votes
1answer
39 views

BioJava - Protein to DNA

Using Biojava 5, I am trying to convert a sequence of Amino Acids to a Nucleotide sequence. Any idea how to do this?
6
votes
1answer
326 views

Biohackers Netflix - DNA to binary and video

I'm not sponsored or anything, just interested in their challenge to decipher their DNA code. They encoded their first episode of "Biohackers" video/binary file to DNA code and said if we ...
0
votes
0answers
15 views

Greedy Motif Search [ Reasoning ]

I was able to execute the algorithm correctly. But I'm still trying to get a hold of the result I'm achieving. This is the algorithm I'm trying to understand - http://rosalind.info/problems/ba2d/ If ...
1
vote
1answer
108 views

Need a alternative or more complex version of venn diagram in python for matching dna sequences

I am in google colab and I have combined and set up a data frame list of sequences that goes like this Location ID Sequence 1.1 ........ A ........ AAGAGATA 1.2 ........ A........... ...
0
votes
2answers
56 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
0
votes
2answers
49 views

Transcribing DNA exons and append transcripts into a list

I am trying to find a way to read and transcribe a list of DNA sequences (list of lists) only when the for loop finds a start codon (triplet of the list items) and until it finds a stop codon, over ...
0
votes
0answers
15 views

Swapping to effect increasing allele in case/control studies

I want to find the effect-increasing allele for a given set of SNPs. For quantitive traits, I understand the effect sign is changed when the A1 and A2 are swapped. How does this work for odds ratios? ...
1
vote
0answers
36 views

“How the clustal omega can be reverse engineered, to trace ancestral inversion mutations via the guide tree?”

I apologise for very basic question but I am very new to biology and have very specific knowledge of this field, I am currently working on Bioinformatics in my machine learning project which is why I ...
1
vote
1answer
35 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
0
votes
0answers
37 views

Coding vs non-coding DNA length

I am trying to calculate the total exonic length (in bp) in order to see where the coding-noncoding ratio of roughly 1% to 99% comes from. We know all chromosomes total about 3 billion base pairs. So ...
0
votes
0answers
91 views

Calculate Entropy for DNA Multiple Sequence Alignment in R

I am pretty new to R. So I apologize for asking maybe a very basic question. Let's say I have a fasta file with sequence below: ...
0
votes
1answer
35 views

Encoding a 15bp DNA sequence into a shorter than 15 digits number

I have a series of 15bp DNA sequences from single-cell barcodes and I would like to encode them into a shorter than 15 digits number so that each unique 15bp DNA sequence will create a unique numeric ...
0
votes
0answers
34 views

How many markers or loci are used in forensic DNA profiling and the effect of the DNA sequencing?

I am reading the Wikipedia page on DNA profiling, specifically the STR analysis. It says the DNA profiling relies on 20 or so loci matching. It also gives an account of finding false identification. ...
0
votes
0answers
21 views

Generating taxonomic hierarchy by species/genus name

I am attempting to create a reference library of DNA plant barcodes in the ITS2 barcode region for plants from a specific region (Panama). I downloaded all the sequences for plants that resulted in a ...
1
vote
0answers
49 views

What steps should I follow for DNA analysis, for a classification problem?

I have a bed file which contains DNA sequences information as follow: ** ...
1
vote
0answers
18 views

mining DNA barcodes from Genebank/BOLD per location

Is there a method to download all the sequences for a particular geographic region (Panama) for 'DNA barcode' sequences (ITS2, rbcL or trnL). Hopefully, the specimen collection location will include ...
1
vote
0answers
39 views

Is there a software that can predict protein-DNA binding?

Is there any software that, given a DNA sequence as input, can predict what protein/ type of protein can bind to the DNA. The sequence of interest is a potential transcriptional regulator, I want to ...
0
votes
1answer
31 views

How can I extract all known mutations of my BAM (or SNP/INDL files)?

I am using a Genome Explorer tool to see all the mutations on my own DNA. My particular interest is on listing the variants and get their names/ids. Here are a few screenshots: You can see that ...
1
vote
1answer
46 views

How can I convert codon coordinates to genomic position?

I am looking for a given mutation in IGV, which accepts coordinates in the form of chr<X>:<Y> Where X is the chromosome number and Y is the base ...
0
votes
1answer
108 views

Get regions' information from DNA sequence data (bsgenome.hsapiens.ucsc.hg19)

I have a problem in R. I have the following dataSet (the first three rows shown) (the 5th number is the methylation level in its region): ...
1
vote
2answers
62 views

Is it possible to go from a digital sequence to an actual nucleotide?

I'm trying to learn about what the state of technology is at presently. It seems like we clearly can go from nucleotide to digitally stored sequence, but can we transcribe something from the digital ...
2
votes
1answer
81 views

Problem with classification model of genomic data: every machine learing model predicts wrongly almost always the same subset of dataset

First of all, I'd like to apologize for any spelling or grammar mistakes. I'm having a problem using R for a classification problem. My dataset contains ~300.000 genomic data, and the features are ...
1
vote
0answers
36 views

Unmapping Alternative reads in BAM file

I want to do some HLA typing, most of the tools require the bam file is aligned to primary genome without alternative read handling. From the International Genome Sample Resource project, I can get ...
1
vote
1answer
42 views

Why do we scale the rate matrix of a substitution model to make the average rate of substitution equal 1?

The matrix of transition probabilities for a substitution model Q over time t is found as follows: $e^{Qt}$. Since Q and t only show up as a product, we cannot distinguish time and rate of change. So ...
7
votes
2answers
309 views

Theoretical limit of human genome compression

How small can a compressed file containing the human genome be? I'm aware that this question cannot actually be answered, since it is asking for the Kolmogorov complexity of the human genome, which is ...
1
vote
1answer
70 views

Compressing the human genome to few megabytes

Multiple sources (see for instance this or this) discuss how genetic data will have scalability problems, given the huge file size of the human genome. The most straightforward encoding (see here) of ...
21
votes
8answers
5k views

Since every human has a different DNA (different combinations of C, G, A, T) what does it mean to have the genome done? [closed]

I'm confused about the difference between genome and DNA. Is it correct to say that the same type of bacteria has the same DNA? But my understanding is that it is not correct to say that the same type ...
1
vote
0answers
25 views

What are the meanings of these transcript ids?

I have three types of transcripts for Rosa chinensis "Old Blush" homozygous genome v2.0 from GDR genome browser. ...